ILK

integrin-linked kinase

105 Gene Product Result for

Synonyms: ILK-1 ILK-2 P59 p59ILK

Species: Human ILK(3611), Mouse Ilk(16202), Rat Ilk(170922), Zebrafish ilk(393543), cow ILK(540207), domestic cat ILK(101092790), chicken ILK(374018), fruit fly Ilk(53573), dog ILK(476836), sheep ILK(100913157), domestic guinea pig Ilk(100135559), naked mole-rat Ilk(101706216)

UniProtKB ID: Q13418, D3DQU0, P57043, Q68DZ3

Gene ID:

Human(3611) Summary: This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Mouse(16202) integrin linked kinase

Rat(170922) integrin-linked kinase

Zebrafish(393543) integrin linked kinase

cow(540207) integrin-linked kinase

domestic cat(101092790) integrin-linked kinase

chicken(374018) integrin-linked kinase

fruit fly(53573) Integrin linked kinase

dog(476836) integrin-linked kinase

sheep(100913157) integrin-linked kinase

domestic guinea pig(100135559) integrin linked kinase

naked mole-rat(101706216) integrin-linked kinase

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB2501564	Anti-ILK (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution	mouse, human, rat, canine	ELISA, western blot	pricing

SAB2701733	Anti-ilk antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	zebrafish	immunohistochemistry, western blot	pricing

SAB2701795	Anti-ilk antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	zebrafish	immunohistochemistry, western blot	pricing

I1907	Anti-ILK antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human, chicken, mouse	immunofluorescence, microarray, western blot	pricing

SAB4501551	Anti-ILK antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, immunohistochemistry, western blot	pricing

HPA048437	Anti-ILK antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence, western blot	pricing

I0783	Monoclonal Anti-ILK antibody produced in mouse ~2 mg/mL, clone 65.1, purified immunoglobulin, buffered aqueous solution	canine, rat, monkey, bovine, mouse, human	immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot	pricing

WH0003611M1	Monoclonal Anti-ILK antibody produced in mouse clone 4F10, purified immunoglobulin, buffered aqueous solution	mouse, human, rat	ELISA, immunofluorescence, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST89566	PrEST Antigen ILK Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST26411	SILu^™PrEST ILK SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST26412	SILu^™PrEST ILK SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST26413	SILu^™PrEST ILK SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR01423	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, ILK	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_004517	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_004517	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_004517	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_010562	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_010562	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_010562	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU143271	MISSION^® esiRNA esiRNA human ILK (esiRNA1)	human	pricing

EMU039771	MISSION^® esiRNA esiRNA targeting mouse Ilk (esiRNA1)	mouse	pricing

siRNA Nano Scale

Product #	Description	Species	Add to Cart

SIHK0962	MISSION^® siRNA Human Kinase ILK (siRNA2), Nano Scale 0.25 nmol	human	pricing

SIHK0961	MISSION^® siRNA Human Kinase ILK (siRNA1), Nano Scale 0.25 nmol	human	pricing

SIHK0963	MISSION^® siRNA Human Kinase ILK (siRNA3), Nano Scale 0.25 nmol	human	pricing

Related Products

Product #	Description	Add to Cart

05-1051	Anti-ILK Antibody, clone 6G6.3 Anti-ILK Antibody, clone 6G6.3 detects level of ILK & has been published & validated for use in WB.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_001014794	siRNAs that have been validated in the lab	human	pricing
NM_001014795	siRNAs that have been validated in the lab	human	pricing
NM_004517	siRNAs that have been validated in the lab	human	pricing
NM_133409	Rosetta Predictions	rat	pricing
NM_010562	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001014794	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00222548 validated	1087
2	SASI_Hs01_00222546 predicted	1150
3	SASI_Hs02_00306563 predicted	1211
4	SASI_Hs01_00222547 predicted	1102
5	SASI_Hs01_00222549 predicted	705
6	SASI_Hs01_00222550 predicted	1231
7	SASI_Hs01_00222551 predicted	729
8	SASI_Hs02_00306564 predicted	606
9	SASI_Hs01_00222552 predicted	1128
10	SASI_Hs01_00222553 predicted	773
11	SASI_Hs01_00222554 predicted	1323
12	SASI_Hs01_00222555 predicted	363

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001014795	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00088931 validated	1253
2	SASI_Hs01_00088929 predicted	1303
3	SASI_Hs02_00306565 predicted	1380
4	SASI_Hs01_00088930 predicted	1255
5	SASI_Hs01_00088932 predicted	861
6	SASI_Hs01_00088933 predicted	1394
7	SASI_Hs01_00088934 predicted	892
8	SASI_Hs02_00306566 predicted	767
9	SASI_Hs01_00088935 predicted	1289
10	SASI_Hs01_00088936 predicted	932
11	SASI_Hs01_00088937 predicted	1487
12	SASI_Hs01_00088938 predicted	524

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_004517	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00014216 validated	753
1	SASI_Hs01_00014214 validated	1145
1	SASI_Hs01_00014213 validated	1196
1	SASI_Hs01_00014215 validated	1138
2	SASI_Hs02_00337796 predicted	1266
3	SASI_Hs01_00014217 predicted	1282
4	SASI_Hs01_00014218 predicted	783
5	SASI_Hs02_00337797 predicted	661
6	SASI_Hs01_00014219 predicted	1180
7	SASI_Hs01_00014220 predicted	821
8	SASI_Hs01_00014221 predicted	1365
9	SASI_Hs01_00014222 predicted	407

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_133409	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00080319 predicted	1233
2	SASI_Rn01_00080320 predicted	1055
3	SASI_Rn01_00080321 predicted	619
4	SASI_Rn01_00080322 predicted	533
5	SASI_Rn01_00080323 predicted	703
6	SASI_Rn01_00080324 predicted	871
7	SASI_Rn01_00080325 predicted	1364
8	SASI_Rn01_00080326 predicted	656
9	SASI_Rn01_00080327 predicted	1017
10	SASI_Rn01_00080328 predicted	880

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_010562	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00086111 predicted	1072
2	SASI_Mm01_00086113 predicted	1062
3	SASI_Mm01_00086114 predicted	674
4	SASI_Mm01_00086115 predicted	1109
5	SASI_Mm01_00086116 predicted	393
6	SASI_Mm01_00086117 predicted	936
7	SASI_Mm01_00086118 predicted	1036
8	SASI_Mm01_00086119 predicted	1237
9	SASI_Mm02_00318840 predicted	582
10	SASI_Mm01_00086120 predicted	1279
11	SASI_Mm01_00086112 predicted	931

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_004517 VALIDATED	ILK MISSION shRNA Bacterial Glycerol Stock integrin-linked kinase	Human

14 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000000968
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.x-1688s1c1
	Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000972
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.x-1100s1c1
	Sequence:CCGGTCCCACGACATGCACTCAATACTCGAGTATTGAGTGCATGTCGTGGGATTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000971
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.x-700s1c1
	Sequence:CCGGCTGAACAAACACTCTGGCATTCTCGAGAATGCCAGAGTGTTTGTTCAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000969
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.x-687s1c1
	Sequence:CCGGCCGAAATGGAACCCTGAACAACTCGAGTTGTTCAGGGTTCCATTTCGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1147s21c1
	Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000297330
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-442s21c1
	Sequence:CCGGGCAGTACAAGGCAGACATCAACTCGAGTTGATGTCTGCCTTGTACTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194750
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-1487s1c1
	Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195112
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-1147s1c1
	Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199581
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.2-1541s1c1
	Sequence:CCGGGACTGGAAGGTCCTTGCCTGACTCGAGTCAGGCAAGGACCTTCCAGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199863
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.2-1136s1c1
	Sequence:CCGGGCACTCAATAGCCGTAGTGTACTCGAGTACACTACGGCTATTGAGTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279845
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004517.2-822s21c1
	Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279854
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1716s21c1
	Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199983
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-822s1c1
	Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279778
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1487s21c1
	Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_004517 VALIDATED	ILK MISSION shRNA shRNA Plasmid DNA integrin-linked kinase	Human

14 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000000968
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.x-1688s1c1
	Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000972
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.x-1100s1c1
	Sequence:CCGGTCCCACGACATGCACTCAATACTCGAGTATTGAGTGCATGTCGTGGGATTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000971
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.x-700s1c1
	Sequence:CCGGCTGAACAAACACTCTGGCATTCTCGAGAATGCCAGAGTGTTTGTTCAGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000969
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.x-687s1c1
	Sequence:CCGGCCGAAATGGAACCCTGAACAACTCGAGTTGTTCAGGGTTCCATTTCGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1147s21c1
	Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000297330
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-442s21c1
	Sequence:CCGGGCAGTACAAGGCAGACATCAACTCGAGTTGATGTCTGCCTTGTACTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194750
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-1487s1c1
	Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195112
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-1147s1c1
	Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199581
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.2-1541s1c1
	Sequence:CCGGGACTGGAAGGTCCTTGCCTGACTCGAGTCAGGCAAGGACCTTCCAGTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199863
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.2-1136s1c1
	Sequence:CCGGGCACTCAATAGCCGTAGTGTACTCGAGTACACTACGGCTATTGAGTGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279845
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004517.2-822s21c1
	Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279854
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1716s21c1
	Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199983
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-822s1c1
	Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279778
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1487s21c1
	Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_004517 VALIDATED	ILK MISSION shRNA Lentiviral Transduction Particles integrin-linked kinase	Human

14 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000000968
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.x-1688s1c1
	Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000972
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.x-1100s1c1
	Sequence:CCGGTCCCACGACATGCACTCAATACTCGAGTATTGAGTGCATGTCGTGGGATTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000971
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.x-700s1c1
	Sequence:CCGGCTGAACAAACACTCTGGCATTCTCGAGAATGCCAGAGTGTTTGTTCAGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000969
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.x-687s1c1
	Sequence:CCGGCCGAAATGGAACCCTGAACAACTCGAGTTGTTCAGGGTTCCATTTCGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1147s21c1
	Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000297330
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-442s21c1
	Sequence:CCGGGCAGTACAAGGCAGACATCAACTCGAGTTGATGTCTGCCTTGTACTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194750
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-1487s1c1
	Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195112
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-1147s1c1
	Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199581
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.2-1541s1c1
	Sequence:CCGGGACTGGAAGGTCCTTGCCTGACTCGAGTCAGGCAAGGACCTTCCAGTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199863
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004517.2-1136s1c1
	Sequence:CCGGGCACTCAATAGCCGTAGTGTACTCGAGTACACTACGGCTATTGAGTGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279845
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004517.2-822s21c1
	Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279854
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1716s21c1
	Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199983
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 1	Clone ID:NM_004517.2-822s1c1
	Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000279778
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004517.2-1487s21c1
	Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_010562 VALIDATED	ILK MISSION shRNA Bacterial Glycerol Stock integrin-linked kinase	Mouse

8 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000280550
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-285s21c1
	Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022516
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010562.1-384s1c1
	Sequence:CCGGGCTGACACCAATGCAGTGAATCTCGAGATTCACTGCATTGGTGTCAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022515
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010562.1-285s1c1
	Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022518
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010562.1-656s1c1
	Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022517
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010562.1-1418s1c1
	Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280490
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-1418s21c1
	Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280489
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-656s21c1
	Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280549
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-989s21c1
	Sequence:CCGGCCAAGCTGTAAAGTTTGCTTTCTCGAGAAAGCAAACTTTACAGCTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_010562 VALIDATED	ILK MISSION shRNA shRNA Plasmid DNA integrin-linked kinase	Mouse

8 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000280550
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-285s21c1
	Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022516
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010562.1-384s1c1
	Sequence:CCGGGCTGACACCAATGCAGTGAATCTCGAGATTCACTGCATTGGTGTCAGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022515
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010562.1-285s1c1
	Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022518
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010562.1-656s1c1
	Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022517
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010562.1-1418s1c1
	Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280490
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-1418s21c1
	Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280489
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-656s21c1
	Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280549
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-989s21c1
	Sequence:CCGGCCAAGCTGTAAAGTTTGCTTTCTCGAGAAAGCAAACTTTACAGCTTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_010562 VALIDATED	ILK MISSION shRNA Lentiviral Transduction Particles integrin-linked kinase	Mouse

8 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000280550
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-285s21c1
	Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022516
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010562.1-384s1c1
	Sequence:CCGGGCTGACACCAATGCAGTGAATCTCGAGATTCACTGCATTGGTGTCAGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022515
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010562.1-285s1c1
	Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022518
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010562.1-656s1c1
	Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022517
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010562.1-1418s1c1
	Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280490
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-1418s21c1
	Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280489
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-656s21c1
	Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280549
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010562.1-989s21c1
	Sequence:CCGGCCAAGCTGTAAAGTTTGCTTTCTCGAGAAAGCAAACTTTACAGCTTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart