EMAIL THIS PAGE TO A FRIEND

ILK

integrin-linked kinase

117 Gene Product Result for
Synonyms: ILK-1 ILK-2 P59 p59ILK
UniProtKB ID: Q13418, D3DQU0, P57043, Q68DZ3
Gene ID:
Human(3611) Summary: This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(16202) integrin linked kinase
Rat(170922) integrin-linked kinase
Zebrafish(393543) integrin linked kinase
cow(540207) integrin-linked kinase
domestic cat(101092790) integrin-linked kinase
chicken(374018) integrin-linked kinase
fruit fly(53573) Integrin linked kinase
dog(476836) integrin-linked kinase
sheep(100913157) integrin-linked kinase
domestic guinea pig(100135559) integrin linked kinase
naked mole-rat(101706216) integrin-linked kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501564 Anti-ILK (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat, canine
ELISA, western blot pricing
SAB2701733 Anti-ilk antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701795 Anti-ilk antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
I1907 Anti-ILK antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, chicken, mouse
immunofluorescence, microarray, western blot pricing
SAB4501551 Anti-ILK antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
HPA048437 Anti-ILK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1306382 ANTI-ILK1/ILK2(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305682 ANTI-ILK2/ILK1(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4301295 Anti-phospho-ILK (pSer246) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
I0783 Monoclonal Anti-ILK antibody produced in mouse ~2 mg/mL, clone 65.1, purified immunoglobulin, buffered aqueous solution canine, rat, monkey, bovine, mouse, human
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
WH0003611M1 Monoclonal Anti-ILK antibody produced in mouse clone 4F10, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004517 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014794 siRNAs that have been validated in the lab human pricing
NM_001014795 siRNAs that have been validated in the lab human pricing
NM_004517 siRNAs that have been validated in the lab human pricing
NM_133409 Rosetta Predictions rat pricing
NM_010562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014794 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222548 validated 1087
2 SASI_Hs01_00222546 predicted 1150
3 SASI_Hs02_00306563 predicted 1211
4 SASI_Hs01_00222547 predicted 1102
5 SASI_Hs01_00222549 predicted 705
6 SASI_Hs01_00222550 predicted 1231
7 SASI_Hs01_00222551 predicted 729
8 SASI_Hs02_00306564 predicted 606
9 SASI_Hs01_00222552 predicted 1128
10 SASI_Hs01_00222553 predicted 773
11 SASI_Hs01_00222554 predicted 1323
12 SASI_Hs01_00222555 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014795 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088931 validated 1253
2 SASI_Hs01_00088929 predicted 1303
3 SASI_Hs02_00306565 predicted 1380
4 SASI_Hs01_00088930 predicted 1255
5 SASI_Hs01_00088932 predicted 861
6 SASI_Hs01_00088933 predicted 1394
7 SASI_Hs01_00088934 predicted 892
8 SASI_Hs02_00306566 predicted 767
9 SASI_Hs01_00088935 predicted 1289
10 SASI_Hs01_00088936 predicted 932
11 SASI_Hs01_00088937 predicted 1487
12 SASI_Hs01_00088938 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004517 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014216 validated 753
1 SASI_Hs01_00014214 validated 1145
1 SASI_Hs01_00014213 validated 1196
1 SASI_Hs01_00014215 validated 1138
2 SASI_Hs02_00337796 predicted 1266
3 SASI_Hs01_00014217 predicted 1282
4 SASI_Hs01_00014218 predicted 783
5 SASI_Hs02_00337797 predicted 661
6 SASI_Hs01_00014219 predicted 1180
7 SASI_Hs01_00014220 predicted 821
8 SASI_Hs01_00014221 predicted 1365
9 SASI_Hs01_00014222 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080319 predicted 1233
2 SASI_Rn01_00080320 predicted 1055
3 SASI_Rn01_00080321 predicted 619
4 SASI_Rn01_00080322 predicted 533
5 SASI_Rn01_00080323 predicted 703
6 SASI_Rn01_00080324 predicted 871
7 SASI_Rn01_00080325 predicted 1364
8 SASI_Rn01_00080326 predicted 656
9 SASI_Rn01_00080327 predicted 1017
10 SASI_Rn01_00080328 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086111 predicted 1072
2 SASI_Mm01_00086113 predicted 1062
3 SASI_Mm01_00086114 predicted 674
4 SASI_Mm01_00086115 predicted 1109
5 SASI_Mm01_00086116 predicted 393
6 SASI_Mm01_00086117 predicted 936
7 SASI_Mm01_00086118 predicted 1036
8 SASI_Mm01_00086119 predicted 1237
9 SASI_Mm02_00318840 predicted 582
10 SASI_Mm01_00086120 predicted 1279
11 SASI_Mm01_00086112 predicted 931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004517
VALIDATED
ILK MISSION shRNA Bacterial Glycerol Stock
integrin-linked kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-442s21c1
Sequence:CCGGGCAGTACAAGGCAGACATCAACTCGAGTTGATGTCTGCCTTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1487s21c1
Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1716s21c1
Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1147s21c1
Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004517.2-822s21c1
Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-822s1c1
Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.2-1136s1c1
Sequence:CCGGGCACTCAATAGCCGTAGTGTACTCGAGTACACTACGGCTATTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-1487s1c1
Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-1147s1c1
Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.2-1541s1c1
Sequence:CCGGGACTGGAAGGTCCTTGCCTGACTCGAGTCAGGCAAGGACCTTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.x-1688s1c1
Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.x-1100s1c1
Sequence:CCGGTCCCACGACATGCACTCAATACTCGAGTATTGAGTGCATGTCGTGGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.x-687s1c1
Sequence:CCGGCCGAAATGGAACCCTGAACAACTCGAGTTGTTCAGGGTTCCATTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.x-700s1c1
Sequence:CCGGCTGAACAAACACTCTGGCATTCTCGAGAATGCCAGAGTGTTTGTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004517
VALIDATED
ILK MISSION shRNA shRNA Plasmid DNA
integrin-linked kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-442s21c1
Sequence:CCGGGCAGTACAAGGCAGACATCAACTCGAGTTGATGTCTGCCTTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1487s21c1
Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1716s21c1
Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1147s21c1
Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004517.2-822s21c1
Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-822s1c1
Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.2-1136s1c1
Sequence:CCGGGCACTCAATAGCCGTAGTGTACTCGAGTACACTACGGCTATTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-1487s1c1
Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-1147s1c1
Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.2-1541s1c1
Sequence:CCGGGACTGGAAGGTCCTTGCCTGACTCGAGTCAGGCAAGGACCTTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.x-1688s1c1
Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.x-1100s1c1
Sequence:CCGGTCCCACGACATGCACTCAATACTCGAGTATTGAGTGCATGTCGTGGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.x-687s1c1
Sequence:CCGGCCGAAATGGAACCCTGAACAACTCGAGTTGTTCAGGGTTCCATTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.x-700s1c1
Sequence:CCGGCTGAACAAACACTCTGGCATTCTCGAGAATGCCAGAGTGTTTGTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004517
VALIDATED
ILK MISSION shRNA Lentiviral Transduction Particles
integrin-linked kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-442s21c1
Sequence:CCGGGCAGTACAAGGCAGACATCAACTCGAGTTGATGTCTGCCTTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1487s21c1
Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1716s21c1
Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004517.2-1147s21c1
Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004517.2-822s21c1
Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-822s1c1
Sequence:CCGGGCAATGACATTGTCGTGAAGGCTCGAGCCTTCACGACAATGTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.2-1136s1c1
Sequence:CCGGGCACTCAATAGCCGTAGTGTACTCGAGTACACTACGGCTATTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-1487s1c1
Sequence:CCGGCGACCCAAATTTGACATGATTCTCGAGAATCATGTCAAATTTGGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.2-1147s1c1
Sequence:CCGGCCGTAGTGTAATGATTGATGACTCGAGTCATCAATCATTACACTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.2-1541s1c1
Sequence:CCGGGACTGGAAGGTCCTTGCCTGACTCGAGTCAGGCAAGGACCTTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.x-1688s1c1
Sequence:CCGGTCAGAGCTTTGTCACTTGCCACTCGAGTGGCAAGTGACAAAGCTCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004517.x-1100s1c1
Sequence:CCGGTCCCACGACATGCACTCAATACTCGAGTATTGAGTGCATGTCGTGGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.x-687s1c1
Sequence:CCGGCCGAAATGGAACCCTGAACAACTCGAGTTGTTCAGGGTTCCATTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004517.x-700s1c1
Sequence:CCGGCTGAACAAACACTCTGGCATTCTCGAGAATGCCAGAGTGTTTGTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010562
VALIDATED
ILK MISSION shRNA Bacterial Glycerol Stock
integrin-linked kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-285s21c1
Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-656s21c1
Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-989s21c1
Sequence:CCGGCCAAGCTGTAAAGTTTGCTTTCTCGAGAAAGCAAACTTTACAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-1418s21c1
Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010562.1-285s1c1
Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010562.1-384s1c1
Sequence:CCGGGCTGACACCAATGCAGTGAATCTCGAGATTCACTGCATTGGTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010562.1-1418s1c1
Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010562.1-656s1c1
Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010562
VALIDATED
ILK MISSION shRNA shRNA Plasmid DNA
integrin-linked kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-285s21c1
Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-656s21c1
Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-989s21c1
Sequence:CCGGCCAAGCTGTAAAGTTTGCTTTCTCGAGAAAGCAAACTTTACAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-1418s21c1
Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010562.1-285s1c1
Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010562.1-384s1c1
Sequence:CCGGGCTGACACCAATGCAGTGAATCTCGAGATTCACTGCATTGGTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010562.1-1418s1c1
Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010562.1-656s1c1
Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010562
VALIDATED
ILK MISSION shRNA Lentiviral Transduction Particles
integrin-linked kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-285s21c1
Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-656s21c1
Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-989s21c1
Sequence:CCGGCCAAGCTGTAAAGTTTGCTTTCTCGAGAAAGCAAACTTTACAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010562.1-1418s21c1
Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010562.1-285s1c1
Sequence:CCGGGCACGGATTAATGTGATGAATCTCGAGATTCATCACATTAATCCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010562.1-384s1c1
Sequence:CCGGGCTGACACCAATGCAGTGAATCTCGAGATTCACTGCATTGGTGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010562.1-1418s1c1
Sequence:CCGGGCGACCCAAGTTTGACATGATCTCGAGATCATGTCAAACTTGGGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010562.1-656s1c1
Sequence:CCGGCCTGAACAAACACTCCGGTATCTCGAGATACCGGAGTGTTTGTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)