EMAIL THIS PAGE TO A FRIEND

ILKAP

integrin-linked kinase-associated serine/threonine phosphatase

77 Gene Product Result for
Synonyms: ILKAP2 ILKAP3 PP2C-DELTA
UniProtKB ID: Q9H0C8, B3KM39
Gene ID:
Human(80895) Summary: The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
Mouse(67444) integrin-linked kinase-associated serine/threonine phosphatase 2C
Rat(64538) integrin-linked kinase-associated serine/threonine phosphatase
sheep(101109322) integrin-linked kinase-associated serine/threonine phosphatase
Domestic Rabbit(100349464) integrin-linked kinase-associated serine/threonine phosphatase
domestic guinea pig(100713855) integrin-linked kinase-associated serine/threonine phosphatase
naked mole-rat(101722661) integrin-linked kinase-associated serine/threonine phosphatase
chicken(424850) integrin-linked kinase-associated serine/threonine phosphatase
domestic cat(101092876) integrin-linked kinase-associated serine/threonine phosphatase
cow(514223) integrin-linked kinase-associated serine/threonine phosphatase
Horse(100057657) integrin-linked kinase-associated serine/threonine phosphatase
dog(486179) integrin-linked kinase-associated serine/threonine phosphatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030768 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030768 Rosetta Predictions human pricing
NM_176799 Rosetta Predictions human pricing
NM_022606 Rosetta Predictions rat pricing
NM_023343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358306 predicted 1093
2 SASI_Hs02_00358307 predicted 617
3 SASI_Hs01_00157454 predicted 849
4 SASI_Hs01_00157455 predicted 661
5 SASI_Hs01_00157456 predicted 878
6 SASI_Hs01_00157457 predicted 898
7 SASI_Hs02_00358308 predicted 321
8 SASI_Hs02_00358309 predicted 785
9 SASI_Hs02_00358310 predicted 1129
10 SASI_Hs02_00358311 predicted 323
11 SASI_Hs01_00157449 predicted 804
12 SASI_Hs01_00157450 predicted 722
13 SASI_Hs01_00157451 predicted 786
14 SASI_Hs01_00157452 predicted 842
15 SASI_Hs01_00157453 predicted 833
16 SASI_Hs01_00157458 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155109 predicted 305
2 SASI_Hs01_00155110 predicted 600
3 SASI_Hs01_00155111 predicted 287
4 SASI_Hs01_00155112 predicted 283
5 SASI_Hs01_00155113 predicted 798
6 SASI_Hs01_00155114 predicted 778
7 SASI_Hs01_00155115 predicted 434
8 SASI_Hs01_00155116 predicted 817
9 SASI_Hs01_00155117 predicted 183
10 SASI_Hs01_00155118 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088172 predicted 771
2 SASI_Rn01_00088173 predicted 443
3 SASI_Rn01_00088174 predicted 1007
4 SASI_Rn01_00088175 predicted 544
5 SASI_Rn01_00088176 predicted 507
6 SASI_Rn01_00088177 predicted 475
7 SASI_Rn01_00088178 predicted 576
8 SASI_Rn01_00088179 predicted 743
9 SASI_Rn01_00088180 predicted 443
10 SASI_Rn01_00088181 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190992 predicted 553
2 SASI_Mm01_00190993 predicted 554
3 SASI_Mm01_00190994 predicted 477
4 SASI_Mm01_00190995 predicted 805
5 SASI_Mm01_00190996 predicted 589
6 SASI_Mm01_00190997 predicted 666
7 SASI_Mm01_00190998 predicted 774
8 SASI_Mm01_00190999 predicted 788
9 SASI_Mm01_00191000 predicted 606
10 SASI_Mm01_00191001 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030768
ILKAP MISSION shRNA Bacterial Glycerol Stock
integrin-linked kinase-associated serine/threonine phosphatase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030768.2-288s1c1
Sequence:CCGGCCGCTAGCAGTGGCGATTCAGCTCGAGCTGAATCGCCACTGCTAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030768.2-1328s1c1
Sequence:CCGGGAGCACGCATGGTATTGACTTCTCGAGAAGTCAATACCATGCGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-550s1c1
Sequence:CCGGCCTCATTACTCGGGTTTCATACTCGAGTATGAAACCCGAGTAATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-296s1c1
Sequence:CCGGAGTGGCGATTCAGGTTCTCTTCTCGAGAAGAGAACCTGAATCGCCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-928s1c1
Sequence:CCGGAGAGCGGATGAGGATACAGAACTCGAGTTCTGTATCCTCATCCGCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-1147s1c1
Sequence:CCGGCTTCATCTTGTCCTGTCTCGACTCGAGTCGAGACAGGACAAGATGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-897s1c1
Sequence:CCGGTCAGCAAAGAGCATAATCCAACTCGAGTTGGATTATGCTCTTTGCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-820s21c1
Sequence:CCGGTATTGCCAACCTCGGAGATAGCTCGAGCTATCTCCGAGGTTGGCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-553s21c1
Sequence:CCGGCATTACTCGGGTTTCATATTTCTCGAGAAATATGAAACCCGAGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-1107s21c1
Sequence:CCGGATGGGCTCTTCAAGGTCTTTACTCGAGTAAAGACCTTGAAGAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-844s21c1
Sequence:CCGGGGCAATCTTGTGTCGTTATAACTCGAGTTATAACGACACAAGATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030768
ILKAP MISSION shRNA shRNA Plasmid DNA
integrin-linked kinase-associated serine/threonine phosphatase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030768.2-288s1c1
Sequence:CCGGCCGCTAGCAGTGGCGATTCAGCTCGAGCTGAATCGCCACTGCTAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030768.2-1328s1c1
Sequence:CCGGGAGCACGCATGGTATTGACTTCTCGAGAAGTCAATACCATGCGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-550s1c1
Sequence:CCGGCCTCATTACTCGGGTTTCATACTCGAGTATGAAACCCGAGTAATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-296s1c1
Sequence:CCGGAGTGGCGATTCAGGTTCTCTTCTCGAGAAGAGAACCTGAATCGCCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-928s1c1
Sequence:CCGGAGAGCGGATGAGGATACAGAACTCGAGTTCTGTATCCTCATCCGCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-1147s1c1
Sequence:CCGGCTTCATCTTGTCCTGTCTCGACTCGAGTCGAGACAGGACAAGATGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-897s1c1
Sequence:CCGGTCAGCAAAGAGCATAATCCAACTCGAGTTGGATTATGCTCTTTGCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-820s21c1
Sequence:CCGGTATTGCCAACCTCGGAGATAGCTCGAGCTATCTCCGAGGTTGGCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-553s21c1
Sequence:CCGGCATTACTCGGGTTTCATATTTCTCGAGAAATATGAAACCCGAGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-1107s21c1
Sequence:CCGGATGGGCTCTTCAAGGTCTTTACTCGAGTAAAGACCTTGAAGAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-844s21c1
Sequence:CCGGGGCAATCTTGTGTCGTTATAACTCGAGTTATAACGACACAAGATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030768
ILKAP MISSION shRNA Lentiviral Transduction Particles
integrin-linked kinase-associated serine/threonine phosphatase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030768.2-288s1c1
Sequence:CCGGCCGCTAGCAGTGGCGATTCAGCTCGAGCTGAATCGCCACTGCTAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030768.2-1328s1c1
Sequence:CCGGGAGCACGCATGGTATTGACTTCTCGAGAAGTCAATACCATGCGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-550s1c1
Sequence:CCGGCCTCATTACTCGGGTTTCATACTCGAGTATGAAACCCGAGTAATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-296s1c1
Sequence:CCGGAGTGGCGATTCAGGTTCTCTTCTCGAGAAGAGAACCTGAATCGCCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-928s1c1
Sequence:CCGGAGAGCGGATGAGGATACAGAACTCGAGTTCTGTATCCTCATCCGCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-1147s1c1
Sequence:CCGGCTTCATCTTGTCCTGTCTCGACTCGAGTCGAGACAGGACAAGATGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030768.x-897s1c1
Sequence:CCGGTCAGCAAAGAGCATAATCCAACTCGAGTTGGATTATGCTCTTTGCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-820s21c1
Sequence:CCGGTATTGCCAACCTCGGAGATAGCTCGAGCTATCTCCGAGGTTGGCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-553s21c1
Sequence:CCGGCATTACTCGGGTTTCATATTTCTCGAGAAATATGAAACCCGAGTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-1107s21c1
Sequence:CCGGATGGGCTCTTCAAGGTCTTTACTCGAGTAAAGACCTTGAAGAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030768.2-844s21c1
Sequence:CCGGGGCAATCTTGTGTCGTTATAACTCGAGTTATAACGACACAAGATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023343
VALIDATED
ILKAP MISSION shRNA Bacterial Glycerol Stock
integrin-linked kinase-associated serine/threonine phosphatase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-211s1c1
Sequence:CCGGCCTTTACTCTTTGATGATCTTCTCGAGAAGATCATCAAAGAGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-793s1c1
Sequence:CCGGGCAATCCTGTGTCGATATAATCTCGAGATTATATCGACACAGGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-579s1c1
Sequence:CCGGGCACCAGAACTTAATCAGGAACTCGAGTTCCTGATTAAGTTCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-449s1c1
Sequence:CCGGCCCATGTCATCCTGAACGATACTCGAGTATCGTTCAGGATGACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023343.1-582s1c1
Sequence:CCGGCCAGAACTTAATCAGGAAATTCTCGAGAATTTCCTGATTAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023343.2-750s21c1
Sequence:CCGGTGTGGACAACATCCTGTATATCTCGAGATATACAGGATGTTGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-984s21c1
Sequence:CCGGGGTCACATCTGTGCCTGATATCTCGAGATATCAGGCACAGATGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-503s21c1
Sequence:CCGGTTACTCGGGTTTCATACTTTGCTCGAGCAAAGTATGAAACCCGAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-544s21c1
Sequence:CCGGGGAATACGAGCCTCGAAATTTCTCGAGAAATTTCGAGGCTCGTATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-450s21c1
Sequence:CCGGCCATGTCATCCTGAACGATATCTCGAGATATCGTTCAGGATGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-792s21c1
Sequence:CCGGGGCAATCCTGTGTCGATATAACTCGAGTTATATCGACACAGGATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023343
VALIDATED
ILKAP MISSION shRNA shRNA Plasmid DNA
integrin-linked kinase-associated serine/threonine phosphatase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-211s1c1
Sequence:CCGGCCTTTACTCTTTGATGATCTTCTCGAGAAGATCATCAAAGAGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-793s1c1
Sequence:CCGGGCAATCCTGTGTCGATATAATCTCGAGATTATATCGACACAGGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-579s1c1
Sequence:CCGGGCACCAGAACTTAATCAGGAACTCGAGTTCCTGATTAAGTTCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-449s1c1
Sequence:CCGGCCCATGTCATCCTGAACGATACTCGAGTATCGTTCAGGATGACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023343.1-582s1c1
Sequence:CCGGCCAGAACTTAATCAGGAAATTCTCGAGAATTTCCTGATTAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023343.2-750s21c1
Sequence:CCGGTGTGGACAACATCCTGTATATCTCGAGATATACAGGATGTTGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-984s21c1
Sequence:CCGGGGTCACATCTGTGCCTGATATCTCGAGATATCAGGCACAGATGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-503s21c1
Sequence:CCGGTTACTCGGGTTTCATACTTTGCTCGAGCAAAGTATGAAACCCGAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-544s21c1
Sequence:CCGGGGAATACGAGCCTCGAAATTTCTCGAGAAATTTCGAGGCTCGTATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-450s21c1
Sequence:CCGGCCATGTCATCCTGAACGATATCTCGAGATATCGTTCAGGATGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-792s21c1
Sequence:CCGGGGCAATCCTGTGTCGATATAACTCGAGTTATATCGACACAGGATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023343
VALIDATED
ILKAP MISSION shRNA Lentiviral Transduction Particles
integrin-linked kinase-associated serine/threonine phosphatase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-211s1c1
Sequence:CCGGCCTTTACTCTTTGATGATCTTCTCGAGAAGATCATCAAAGAGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-793s1c1
Sequence:CCGGGCAATCCTGTGTCGATATAATCTCGAGATTATATCGACACAGGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-579s1c1
Sequence:CCGGGCACCAGAACTTAATCAGGAACTCGAGTTCCTGATTAAGTTCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023343.1-449s1c1
Sequence:CCGGCCCATGTCATCCTGAACGATACTCGAGTATCGTTCAGGATGACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023343.1-582s1c1
Sequence:CCGGCCAGAACTTAATCAGGAAATTCTCGAGAATTTCCTGATTAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023343.2-750s21c1
Sequence:CCGGTGTGGACAACATCCTGTATATCTCGAGATATACAGGATGTTGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-984s21c1
Sequence:CCGGGGTCACATCTGTGCCTGATATCTCGAGATATCAGGCACAGATGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-503s21c1
Sequence:CCGGTTACTCGGGTTTCATACTTTGCTCGAGCAAAGTATGAAACCCGAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-544s21c1
Sequence:CCGGGGAATACGAGCCTCGAAATTTCTCGAGAAATTTCGAGGCTCGTATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-450s21c1
Sequence:CCGGCCATGTCATCCTGAACGATATCTCGAGATATCGTTCAGGATGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023343.2-792s21c1
Sequence:CCGGGGCAATCCTGTGTCGATATAACTCGAGTTATATCGACACAGGATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)