EMAIL THIS PAGE TO A FRIEND

ILVBL

ilvB (bacterial acetolactate synthase)-like

70 Gene Product Result for
Synonyms: 209L8 AHAS ILV2H
UniProtKB ID: A1L0T0, O43341, Q96F08, Q99651, Q9BWN5, Q9UEB2
Gene ID:
Human(10994) Summary: The protein encoded by this gene shares similarity with several thiamine pyrophosphate-binding proteins identified in bacteria, yeast, and plants. The highest degree of similarity is found with bacterial acetolactate synthases (AHAS), which are enzymes that catalyze the first step in branched-chain amino acid biosynthesis. [provided by RefSeq, Jul 2008]
Mouse(216136) ilvB (bacterial acetolactate synthase)-like
Rat(362843) ilvB (bacterial acetolactate synthase)-like
sheep(101120571) ilvB (bacterial acetolactate synthase)-like
Domestic Rabbit(100353484) ilvB (bacterial acetolactate synthase)-like
domestic guinea pig(100716587) ilvB (bacterial acetolactate synthase)-like
naked mole-rat(101720799) ilvB (bacterial acetolactate synthase)-like
Zebrafish(393639) ilvB (bacterial acetolactate synthase)-like
cow(506955) ilvB (bacterial acetolactate synthase)-like
dog(476683) ilvB (bacterial acetolactate synthase)-like
domestic cat(101099531) ilvB (bacterial acetolactate synthase)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_176826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_006844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006844 Rosetta Predictions human pricing
NM_176826 Rosetta Predictions human pricing
NM_001108738 Rosetta Predictions rat pricing
NM_173751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054577 predicted 1223
2 SASI_Hs02_00342429 predicted 822
3 SASI_Hs02_00342430 predicted 1393
4 SASI_Hs02_00342431 predicted 1156
5 SASI_Hs01_00054580 predicted 2069
6 SASI_Hs02_00342432 predicted 1868
7 SASI_Hs02_00342433 predicted 492
8 SASI_Hs02_00342434 predicted 1244
9 SASI_Hs02_00342435 predicted 1132
10 SASI_Hs02_00342436 predicted 1143
11 SASI_Hs01_00054572 predicted 403
12 SASI_Hs01_00054573 predicted 359
13 SASI_Hs01_00054574 predicted 386
14 SASI_Hs01_00054575 predicted 411
15 SASI_Hs01_00054576 predicted 370
16 SASI_Hs01_00054578 predicted 2238
17 SASI_Hs01_00054579 predicted 2239
18 SASI_Hs01_00054581 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143887 predicted 386
2 SASI_Hs01_00143888 predicted 344
3 SASI_Hs01_00143889 predicted 369
4 SASI_Hs01_00143890 predicted 394
5 SASI_Hs01_00143891 predicted 345
6 SASI_Hs01_00143892 predicted 887
7 SASI_Hs01_00143893 predicted 616
8 SASI_Hs01_00143894 predicted 296
9 SASI_Hs01_00143895 predicted 886
10 SASI_Hs01_00143896 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241595 predicted 2270
2 SASI_Rn02_00241596 predicted 2103
3 SASI_Rn02_00241597 predicted 1858
4 SASI_Rn02_00241598 predicted 1773
5 SASI_Rn02_00241599 predicted 967
6 SASI_Rn02_00241600 predicted 2242
7 SASI_Rn02_00241601 predicted 995
8 SASI_Rn02_00241602 predicted 1128
9 SASI_Rn02_00241603 predicted 1786
10 SASI_Rn02_00241604 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165564 predicted 1914
2 SASI_Mm02_00345395 predicted 2011
3 SASI_Mm01_00165566 predicted 1423
4 SASI_Mm01_00165567 predicted 769
5 SASI_Mm01_00165568 predicted 1717
6 SASI_Mm01_00165569 predicted 1886
7 SASI_Mm01_00165570 predicted 1435
8 SASI_Mm01_00165571 predicted 1510
9 SASI_Mm01_00165572 predicted 1752
10 SASI_Mm01_00165573 predicted 802
11 SASI_Mm01_00165565 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173751
ILVBL MISSION shRNA Bacterial Glycerol Stock
ilvB (bacterial acetolactate synthase)-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173751.3-2073s1c1
Sequence:CCGGGACTTTGTCTACCTGGAGTTTCTCGAGAAACTCCAGGTAGACAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-755s1c1
Sequence:CCGGGCTGCCTCTTGATGTACTATACTCGAGTATAGTACATCAAGAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-1923s1c1
Sequence:CCGGGTGGTCAAGGTACTTCGTGAACTCGAGTTCACGAAGTACCTTGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-1451s1c1
Sequence:CCGGGCCTGTATTACAGCACCTGAACTCGAGTTCAGGTGCTGTAATACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-837s1c2
Sequence:CCGGCGTGTGGTTGTCTGGTATTTACTCGAGTAAATACCAGACAACCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173751
ILVBL MISSION shRNA shRNA Plasmid DNA
ilvB (bacterial acetolactate synthase)-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173751.3-2073s1c1
Sequence:CCGGGACTTTGTCTACCTGGAGTTTCTCGAGAAACTCCAGGTAGACAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-755s1c1
Sequence:CCGGGCTGCCTCTTGATGTACTATACTCGAGTATAGTACATCAAGAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-1923s1c1
Sequence:CCGGGTGGTCAAGGTACTTCGTGAACTCGAGTTCACGAAGTACCTTGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-1451s1c1
Sequence:CCGGGCCTGTATTACAGCACCTGAACTCGAGTTCAGGTGCTGTAATACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-837s1c2
Sequence:CCGGCGTGTGGTTGTCTGGTATTTACTCGAGTAAATACCAGACAACCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173751
ILVBL MISSION shRNA Lentiviral Transduction Particles
ilvB (bacterial acetolactate synthase)-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173751.3-2073s1c1
Sequence:CCGGGACTTTGTCTACCTGGAGTTTCTCGAGAAACTCCAGGTAGACAAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-755s1c1
Sequence:CCGGGCTGCCTCTTGATGTACTATACTCGAGTATAGTACATCAAGAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-1923s1c1
Sequence:CCGGGTGGTCAAGGTACTTCGTGAACTCGAGTTCACGAAGTACCTTGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-1451s1c1
Sequence:CCGGGCCTGTATTACAGCACCTGAACTCGAGTTCAGGTGCTGTAATACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173751.3-837s1c2
Sequence:CCGGCGTGTGGTTGTCTGGTATTTACTCGAGTAAATACCAGACAACCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176826
VALIDATED
ILVBL MISSION shRNA Bacterial Glycerol Stock
ilvB (bacterial acetolactate synthase)-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_176826.x-857s1c1
Sequence:CCGGCCTCTTCACGGACCCAACTGTCTCGAGACAGTTGGGTCCGTGAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-663s1c1
Sequence:CCGGCATTGCTGTATAGGGCCTTGTCTCGAGACAAGGCCCTATACAGCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-400s1c1
Sequence:CCGGCCGTCTTTGCTGCTGATGCTACTCGAGTAGCATCAGCAGCAAAGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-351s1c1
Sequence:CCGGTGTGAGAAACTGGGCATCCGTCTCGAGACGGATGCCCAGTTTCTCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_176826.x-738s1c1
Sequence:CCGGAGTCTCATCATTGCTTGCCCTCTCGAGAGGGCAAGCAATGATGAGACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176826
VALIDATED
ILVBL MISSION shRNA shRNA Plasmid DNA
ilvB (bacterial acetolactate synthase)-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_176826.x-857s1c1
Sequence:CCGGCCTCTTCACGGACCCAACTGTCTCGAGACAGTTGGGTCCGTGAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-663s1c1
Sequence:CCGGCATTGCTGTATAGGGCCTTGTCTCGAGACAAGGCCCTATACAGCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-400s1c1
Sequence:CCGGCCGTCTTTGCTGCTGATGCTACTCGAGTAGCATCAGCAGCAAAGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-351s1c1
Sequence:CCGGTGTGAGAAACTGGGCATCCGTCTCGAGACGGATGCCCAGTTTCTCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_176826.x-738s1c1
Sequence:CCGGAGTCTCATCATTGCTTGCCCTCTCGAGAGGGCAAGCAATGATGAGACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176826
VALIDATED
ILVBL MISSION shRNA Lentiviral Transduction Particles
ilvB (bacterial acetolactate synthase)-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_176826.x-857s1c1
Sequence:CCGGCCTCTTCACGGACCCAACTGTCTCGAGACAGTTGGGTCCGTGAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-663s1c1
Sequence:CCGGCATTGCTGTATAGGGCCTTGTCTCGAGACAAGGCCCTATACAGCAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-400s1c1
Sequence:CCGGCCGTCTTTGCTGCTGATGCTACTCGAGTAGCATCAGCAGCAAAGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176826.x-351s1c1
Sequence:CCGGTGTGAGAAACTGGGCATCCGTCTCGAGACGGATGCCCAGTTTCTCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_176826.x-738s1c1
Sequence:CCGGAGTCTCATCATTGCTTGCCCTCTCGAGAGGGCAAGCAATGATGAGACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006844
ILVBL MISSION shRNA Bacterial Glycerol Stock
ilvB (bacterial acetolactate synthase)-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1827s21c1
Sequence:CCGGGCCTGGCCTACACTGATTATCCTCGAGGATAATCAGTGTAGGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-824s21c1
Sequence:CCGGCGAGTGGTCTCCTGGTATTTACTCGAGTAAATACCAGGAGACCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1695s21c1
Sequence:CCGGGCTACAGCCTCATCGAATTTGCTCGAGCAAATTCGATGAGGCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1764s21c1
Sequence:CCGGATGCTGGCTGGACACAGATTTCTCGAGAAATCTGTGTCCAGCCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006844.3-2075s21c1
Sequence:CCGGTGGTTTGGAGTCTCATCATTGCTCGAGCAATGATGAGACTCCAAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1229s21c1
Sequence:CCGGATCATCATCGTCAATCGTAATCTCGAGATTACGATTGACGATGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1490s21c1
Sequence:CCGGACGCTACCTGACAACTCAATTCTCGAGAATTGAGTTGTCAGGTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006844
ILVBL MISSION shRNA shRNA Plasmid DNA
ilvB (bacterial acetolactate synthase)-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1827s21c1
Sequence:CCGGGCCTGGCCTACACTGATTATCCTCGAGGATAATCAGTGTAGGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-824s21c1
Sequence:CCGGCGAGTGGTCTCCTGGTATTTACTCGAGTAAATACCAGGAGACCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1695s21c1
Sequence:CCGGGCTACAGCCTCATCGAATTTGCTCGAGCAAATTCGATGAGGCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1764s21c1
Sequence:CCGGATGCTGGCTGGACACAGATTTCTCGAGAAATCTGTGTCCAGCCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006844.3-2075s21c1
Sequence:CCGGTGGTTTGGAGTCTCATCATTGCTCGAGCAATGATGAGACTCCAAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1229s21c1
Sequence:CCGGATCATCATCGTCAATCGTAATCTCGAGATTACGATTGACGATGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1490s21c1
Sequence:CCGGACGCTACCTGACAACTCAATTCTCGAGAATTGAGTTGTCAGGTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006844
ILVBL MISSION shRNA Lentiviral Transduction Particles
ilvB (bacterial acetolactate synthase)-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1827s21c1
Sequence:CCGGGCCTGGCCTACACTGATTATCCTCGAGGATAATCAGTGTAGGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-824s21c1
Sequence:CCGGCGAGTGGTCTCCTGGTATTTACTCGAGTAAATACCAGGAGACCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1695s21c1
Sequence:CCGGGCTACAGCCTCATCGAATTTGCTCGAGCAAATTCGATGAGGCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1764s21c1
Sequence:CCGGATGCTGGCTGGACACAGATTTCTCGAGAAATCTGTGTCCAGCCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006844.3-2075s21c1
Sequence:CCGGTGGTTTGGAGTCTCATCATTGCTCGAGCAATGATGAGACTCCAAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1229s21c1
Sequence:CCGGATCATCATCGTCAATCGTAATCTCGAGATTACGATTGACGATGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006844.3-1490s21c1
Sequence:CCGGACGCTACCTGACAACTCAATTCTCGAGAATTGAGTTGTCAGGTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)