EMAIL THIS PAGE TO A FRIEND

IMMP1L

IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)

62 Gene Product Result for
Synonyms: IMP1 IMP1-LIKE
UniProtKB ID: Q96LU5, D3DQZ7, Q96SH9
Gene ID:
Human(196294) Summary: The mitochondrial inner membrane peptidase (IMP) complex generates mature, active proteins in the mitochondrial intermembrane space by proteolytically removing the mitochondrial targeting presequence of nuclear-encoded proteins. IMP1 and IMP2 (IMMP2L; MIM 605977) are the catalytic subunits of the IMP complex (Burri et al., 2005 [PubMed 15814844]
Mouse(66541) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Rat(691145) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Zebrafish(795154) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
chicken(771365) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
dog(475954) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
domestic cat(101086502) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
cow(617161) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
sheep(101119503) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
domestic guinea pig(100715859) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
naked mole-rat(101709166) IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144981 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046151 MISSION® esiRNA esiRNA human IMMP1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144981 Rosetta Predictions human pricing
XM_001076990 Rosetta Predictions rat pricing
NM_028260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364785 predicted 535
2 SASI_Hs02_00364786 predicted 541
3 SASI_Hs01_00128467 predicted 502
4 SASI_Hs02_00364787 predicted 567
5 SASI_Hs01_00128458 predicted 311
6 SASI_Hs01_00128459 predicted 547
7 SASI_Hs01_00128460 predicted 477
8 SASI_Hs01_00128461 predicted 476
9 SASI_Hs01_00128462 predicted 391
10 SASI_Hs02_00364788 predicted 525
11 SASI_Hs01_00128463 predicted 292
12 SASI_Hs01_00128464 predicted 285
13 SASI_Hs01_00128465 predicted 316
14 SASI_Hs01_00128466 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355332 predicted 243
2 SASI_Rn02_00355333 predicted 329
3 SASI_Rn02_00355334 predicted 357
4 SASI_Rn02_00355335 predicted 191
5 SASI_Rn02_00355336 predicted 116
6 SASI_Rn02_00355337 predicted 420
7 SASI_Rn02_00355338 predicted 187
8 SASI_Rn02_00355339 predicted 298
9 SASI_Rn02_00355340 predicted 398
10 SASI_Rn02_00355341 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333624 predicted 548
2 SASI_Mm01_00129888 predicted 258
3 SASI_Mm01_00129889 predicted 258
4 SASI_Mm01_00129890 predicted 415
5 SASI_Mm02_00333625 predicted 409
6 SASI_Mm01_00129892 predicted 260
7 SASI_Mm02_00333626 predicted 682
8 SASI_Mm01_00129887 predicted 275
9 SASI_Mm01_00129891 predicted 556
10 SASI_Mm02_00333627 predicted 665
11 SASI_Mm01_00129886 predicted 466
12 SASI_Mm01_00129893 predicted 551
13 SASI_Mm01_00129894 predicted 473
14 SASI_Mm01_00129895 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028260
VALIDATED
IMMP1L MISSION shRNA Bacterial Glycerol Stock
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028260.2-777s21c1
Sequence:CCGGCAGTTGAAACCATGAACTTAACTCGAGTTAAGTTCATGGTTTCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-343s21c1
Sequence:CCGGCCATCAATGGAACCCACAATTCTCGAGAATTGTGGGTTCCATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-553s21c1
Sequence:CCGGCCAACAGGTCATGTTTGGTTACTCGAGTAACCAAACATGACCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-667s21c1
Sequence:CCGGCCTTTCAGTGACTTCGGATTTCTCGAGAAATCCGAAGTCACTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-595s21c1
Sequence:CCGGTCTACCGATTCCAGGTATTATCTCGAGATAATACCTGGAATCGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028260.1-776s1c1
Sequence:CCGGTCATCCTTGGAGACAGTGTATCTCGAGATACACTGTCTCCAAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-218s1c1
Sequence:CCGGGCTGGCTATACCATTCAGTATCTCGAGATACTGAATGGTATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-620s1c1
Sequence:CCGGCCTTTCAGTGACTTCGGATTTCTCGAGAAATCCGAAGTCACTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-506s1c1
Sequence:CCGGCCAACAGGTCATGTTTGGTTACTCGAGTAACCAAACATGACCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-296s1c1
Sequence:CCGGCCATCAATGGAACCCACAATTCTCGAGAATTGTGGGTTCCATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028260
VALIDATED
IMMP1L MISSION shRNA shRNA Plasmid DNA
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028260.2-777s21c1
Sequence:CCGGCAGTTGAAACCATGAACTTAACTCGAGTTAAGTTCATGGTTTCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-343s21c1
Sequence:CCGGCCATCAATGGAACCCACAATTCTCGAGAATTGTGGGTTCCATTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-553s21c1
Sequence:CCGGCCAACAGGTCATGTTTGGTTACTCGAGTAACCAAACATGACCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-667s21c1
Sequence:CCGGCCTTTCAGTGACTTCGGATTTCTCGAGAAATCCGAAGTCACTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-595s21c1
Sequence:CCGGTCTACCGATTCCAGGTATTATCTCGAGATAATACCTGGAATCGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028260.1-776s1c1
Sequence:CCGGTCATCCTTGGAGACAGTGTATCTCGAGATACACTGTCTCCAAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-218s1c1
Sequence:CCGGGCTGGCTATACCATTCAGTATCTCGAGATACTGAATGGTATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-620s1c1
Sequence:CCGGCCTTTCAGTGACTTCGGATTTCTCGAGAAATCCGAAGTCACTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-506s1c1
Sequence:CCGGCCAACAGGTCATGTTTGGTTACTCGAGTAACCAAACATGACCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-296s1c1
Sequence:CCGGCCATCAATGGAACCCACAATTCTCGAGAATTGTGGGTTCCATTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028260
VALIDATED
IMMP1L MISSION shRNA Lentiviral Transduction Particles
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028260.2-777s21c1
Sequence:CCGGCAGTTGAAACCATGAACTTAACTCGAGTTAAGTTCATGGTTTCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-343s21c1
Sequence:CCGGCCATCAATGGAACCCACAATTCTCGAGAATTGTGGGTTCCATTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-553s21c1
Sequence:CCGGCCAACAGGTCATGTTTGGTTACTCGAGTAACCAAACATGACCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-667s21c1
Sequence:CCGGCCTTTCAGTGACTTCGGATTTCTCGAGAAATCCGAAGTCACTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028260.2-595s21c1
Sequence:CCGGTCTACCGATTCCAGGTATTATCTCGAGATAATACCTGGAATCGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028260.1-776s1c1
Sequence:CCGGTCATCCTTGGAGACAGTGTATCTCGAGATACACTGTCTCCAAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-218s1c1
Sequence:CCGGGCTGGCTATACCATTCAGTATCTCGAGATACTGAATGGTATAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-620s1c1
Sequence:CCGGCCTTTCAGTGACTTCGGATTTCTCGAGAAATCCGAAGTCACTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-506s1c1
Sequence:CCGGCCAACAGGTCATGTTTGGTTACTCGAGTAACCAAACATGACCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028260.1-296s1c1
Sequence:CCGGCCATCAATGGAACCCACAATTCTCGAGAATTGTGGGTTCCATTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144981
VALIDATED
IMMP1L MISSION shRNA Bacterial Glycerol Stock
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-250s21c1
Sequence:CCGGATATGGCTGTATAGCTCATTGCTCGAGCAATGAGCTATACAGCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-391s21c1
Sequence:GTACCGGAGGTGACATTGTGATTGCAAACTCGAGTTTGCAATCACAATGTCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-573s21c1
Sequence:CCGGCCAGGTGCTATGGACCTATTCCTCGAGGAATAGGTCCATAGCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-311s21c1
Sequence:CCGGCCATCAATGGAGCCTACAATTCTCGAGAATTGTAGGCTCCATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-227s21c1
Sequence:CCGGCGACTTGTTGGCTATACTATTCTCGAGAATAGTATAGCCAACAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-379s1c1
Sequence:CCGGTGGTATCCAAAGAGGTGACATCTCGAGATGTCACCTCTTTGGATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_144981.1-227s1c1
Sequence:CCGGCGACTTGTTGGCTATACTATTCTCGAGAATAGTATAGCCAACAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_144981.1-533s1c1
Sequence:CCGGGTTTGGTTAGAAGGTGACAATCTCGAGATTGTCACCTTCTAACCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-255s1c1
Sequence:CCGGGCTGTATAGCTCATTGTGCTTCTCGAGAAGCACAATGAGCTATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-587s1c1
Sequence:CCGGCCTATTCCATATGGACTAATACTCGAGTATTAGTCCATATGGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144981
VALIDATED
IMMP1L MISSION shRNA shRNA Plasmid DNA
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-250s21c1
Sequence:CCGGATATGGCTGTATAGCTCATTGCTCGAGCAATGAGCTATACAGCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-391s21c1
Sequence:GTACCGGAGGTGACATTGTGATTGCAAACTCGAGTTTGCAATCACAATGTCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-573s21c1
Sequence:CCGGCCAGGTGCTATGGACCTATTCCTCGAGGAATAGGTCCATAGCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-311s21c1
Sequence:CCGGCCATCAATGGAGCCTACAATTCTCGAGAATTGTAGGCTCCATTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-227s21c1
Sequence:CCGGCGACTTGTTGGCTATACTATTCTCGAGAATAGTATAGCCAACAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-379s1c1
Sequence:CCGGTGGTATCCAAAGAGGTGACATCTCGAGATGTCACCTCTTTGGATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_144981.1-227s1c1
Sequence:CCGGCGACTTGTTGGCTATACTATTCTCGAGAATAGTATAGCCAACAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_144981.1-533s1c1
Sequence:CCGGGTTTGGTTAGAAGGTGACAATCTCGAGATTGTCACCTTCTAACCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-255s1c1
Sequence:CCGGGCTGTATAGCTCATTGTGCTTCTCGAGAAGCACAATGAGCTATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-587s1c1
Sequence:CCGGCCTATTCCATATGGACTAATACTCGAGTATTAGTCCATATGGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144981
VALIDATED
IMMP1L MISSION shRNA Lentiviral Transduction Particles
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-250s21c1
Sequence:CCGGATATGGCTGTATAGCTCATTGCTCGAGCAATGAGCTATACAGCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-391s21c1
Sequence:GTACCGGAGGTGACATTGTGATTGCAAACTCGAGTTTGCAATCACAATGTCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-573s21c1
Sequence:CCGGCCAGGTGCTATGGACCTATTCCTCGAGGAATAGGTCCATAGCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-311s21c1
Sequence:CCGGCCATCAATGGAGCCTACAATTCTCGAGAATTGTAGGCTCCATTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144981.1-227s21c1
Sequence:CCGGCGACTTGTTGGCTATACTATTCTCGAGAATAGTATAGCCAACAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-379s1c1
Sequence:CCGGTGGTATCCAAAGAGGTGACATCTCGAGATGTCACCTCTTTGGATACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_144981.1-227s1c1
Sequence:CCGGCGACTTGTTGGCTATACTATTCTCGAGAATAGTATAGCCAACAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_144981.1-533s1c1
Sequence:CCGGGTTTGGTTAGAAGGTGACAATCTCGAGATTGTCACCTTCTAACCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-255s1c1
Sequence:CCGGGCTGTATAGCTCATTGTGCTTCTCGAGAAGCACAATGAGCTATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144981.1-587s1c1
Sequence:CCGGCCTATTCCATATGGACTAATACTCGAGTATTAGTCCATATGGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)