EMAIL THIS PAGE TO A FRIEND

IMMP2L

IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)

95 Gene Product Result for
Synonyms: IMP2 IMP2-LIKE
Gene ID:
Human(83943) Summary: This gene encodes a protein involved in processing the signal peptide sequences used to direct mitochondrial proteins to the mitochondria. The encoded protein resides in the mitochondria and is one of the necessary proteins for the catalytic activity of the mitochondrial inner membrane peptidase (IMP) complex. Two variants that encode the same protein have been described for this gene. [provided by RefSeq, Sep 2011]
Mouse(93757) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Rat(100359529) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
domestic guinea pig(100728050) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
naked mole-rat(101722832) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
sheep(101113581) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Zebrafish(445299) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
dog(611911) mitochondrial inner membrane protease subunit 2-like
cow(768034) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
domestic cat(101082301) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
chicken(417780) IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032549 Rosetta Predictions human pricing
NM_053122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011981 predicted 567
2 SASI_Hs01_00011982 predicted 782
3 SASI_Hs01_00011983 predicted 447
4 SASI_Hs02_00360059 predicted 729
5 SASI_Hs01_00011984 predicted 440
6 SASI_Hs01_00011987 predicted 564
7 SASI_Hs01_00011988 predicted 594
8 SASI_Hs02_00360060 predicted 628
9 SASI_Hs01_00011990 predicted 797
10 SASI_Hs02_00360061 predicted 737
11 SASI_Hs01_00011985 predicted 711
12 SASI_Hs01_00011986 predicted 675
13 SASI_Hs01_00011989 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337631 predicted 819
2 SASI_Mm01_00118822 predicted 354
3 SASI_Mm01_00118823 predicted 916
4 SASI_Mm01_00118824 predicted 412
5 SASI_Mm01_00118825 predicted 344
6 SASI_Mm01_00118826 predicted 906
7 SASI_Mm01_00118827 predicted 880
8 SASI_Mm01_00118829 predicted 734
9 SASI_Mm01_00118830 predicted 493
10 SASI_Mm02_00337632 predicted 414
11 SASI_Mm01_00118828 predicted 775
12 SASI_Mm01_00118831 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032549
VALIDATED
IMMP2L MISSION shRNA Bacterial Glycerol Stock
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-942s1c1
Sequence:CCGGCGCTTACCAGTACAGAGAGAACTCGAGTTCTCTCTGTACTGGTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032549.1-659s1c1
Sequence:CCGGCCGTGGTGACATTGTATCATTCTCGAGAATGATACAATGTCACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-786s1c1
Sequence:CCGGCGTGGTCACATCTGGGTTGAACTCGAGTTCAACCCAGATGTGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-550s1c1
Sequence:CCGGTGGCAAGAGTAGAAGGAGCATCTCGAGATGCTCCTTCTACTCTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032549.1-672s1c1
Sequence:CCGGGTATCATTGGTGTCTCCTAAACTCGAGTTTAGGAGACACCAATGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032549.2-694s21c1
Sequence:CCGGACCCAGAACAGAAGATCATTACTCGAGTAATGATCTTCTGTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-659s21c1
Sequence:CCGGCCGTGGTGACATTGTATCATTCTCGAGAATGATACAATGTCACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-1065s21c1
Sequence:CCGGATATGATGCTGTGCGAGAAATCTCGAGATTTCTCGCACAGCATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-942s21c1
Sequence:CCGGCGCTTACCAGTACAGAGAGAACTCGAGTTCTCTCTGTACTGGTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-672s21c1
Sequence:CCGGGTATCATTGGTGTCTCCTAAACTCGAGTTTAGGAGACACCAATGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032549
VALIDATED
IMMP2L MISSION shRNA shRNA Plasmid DNA
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-942s1c1
Sequence:CCGGCGCTTACCAGTACAGAGAGAACTCGAGTTCTCTCTGTACTGGTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032549.1-659s1c1
Sequence:CCGGCCGTGGTGACATTGTATCATTCTCGAGAATGATACAATGTCACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-786s1c1
Sequence:CCGGCGTGGTCACATCTGGGTTGAACTCGAGTTCAACCCAGATGTGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-550s1c1
Sequence:CCGGTGGCAAGAGTAGAAGGAGCATCTCGAGATGCTCCTTCTACTCTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032549.1-672s1c1
Sequence:CCGGGTATCATTGGTGTCTCCTAAACTCGAGTTTAGGAGACACCAATGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032549.2-694s21c1
Sequence:CCGGACCCAGAACAGAAGATCATTACTCGAGTAATGATCTTCTGTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-659s21c1
Sequence:CCGGCCGTGGTGACATTGTATCATTCTCGAGAATGATACAATGTCACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-1065s21c1
Sequence:CCGGATATGATGCTGTGCGAGAAATCTCGAGATTTCTCGCACAGCATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-942s21c1
Sequence:CCGGCGCTTACCAGTACAGAGAGAACTCGAGTTCTCTCTGTACTGGTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-672s21c1
Sequence:CCGGGTATCATTGGTGTCTCCTAAACTCGAGTTTAGGAGACACCAATGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032549
VALIDATED
IMMP2L MISSION shRNA Lentiviral Transduction Particles
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-942s1c1
Sequence:CCGGCGCTTACCAGTACAGAGAGAACTCGAGTTCTCTCTGTACTGGTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032549.1-659s1c1
Sequence:CCGGCCGTGGTGACATTGTATCATTCTCGAGAATGATACAATGTCACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-786s1c1
Sequence:CCGGCGTGGTCACATCTGGGTTGAACTCGAGTTCAACCCAGATGTGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032549.1-550s1c1
Sequence:CCGGTGGCAAGAGTAGAAGGAGCATCTCGAGATGCTCCTTCTACTCTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032549.1-672s1c1
Sequence:CCGGGTATCATTGGTGTCTCCTAAACTCGAGTTTAGGAGACACCAATGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032549.2-694s21c1
Sequence:CCGGACCCAGAACAGAAGATCATTACTCGAGTAATGATCTTCTGTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-659s21c1
Sequence:CCGGCCGTGGTGACATTGTATCATTCTCGAGAATGATACAATGTCACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-1065s21c1
Sequence:CCGGATATGATGCTGTGCGAGAAATCTCGAGATTTCTCGCACAGCATCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-942s21c1
Sequence:CCGGCGCTTACCAGTACAGAGAGAACTCGAGTTCTCTCTGTACTGGTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032549.2-672s21c1
Sequence:CCGGGTATCATTGGTGTCTCCTAAACTCGAGTTTAGGAGACACCAATGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053122
VALIDATED
IMMP2L MISSION shRNA Bacterial Glycerol Stock
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053122.2-470s1c1
Sequence:CCGGGCGATCATCATGGACACAGTTCTCGAGAACTGTGTCCATGATGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053122.2-956s1c1
Sequence:CCGGGCAGCAAAGATGATTTGTCTTCTCGAGAAGACAAATCATCTTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-611s1c1
Sequence:CCGGCACTCCAGACTGGTGAGAAATCTCGAGATTTCTCACCAGTCTGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-388s1c1
Sequence:CCGGGCTCTTGAAGGAGATATTGTACTCGAGTACAATATCTCCTTCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-321s1c1
Sequence:CCGGGCGTGGTGACATTGTGTCATTCTCGAGAATGACACAATGTCACCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053122
VALIDATED
IMMP2L MISSION shRNA shRNA Plasmid DNA
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053122.2-470s1c1
Sequence:CCGGGCGATCATCATGGACACAGTTCTCGAGAACTGTGTCCATGATGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053122.2-956s1c1
Sequence:CCGGGCAGCAAAGATGATTTGTCTTCTCGAGAAGACAAATCATCTTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-611s1c1
Sequence:CCGGCACTCCAGACTGGTGAGAAATCTCGAGATTTCTCACCAGTCTGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-388s1c1
Sequence:CCGGGCTCTTGAAGGAGATATTGTACTCGAGTACAATATCTCCTTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-321s1c1
Sequence:CCGGGCGTGGTGACATTGTGTCATTCTCGAGAATGACACAATGTCACCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053122
VALIDATED
IMMP2L MISSION shRNA Lentiviral Transduction Particles
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053122.2-470s1c1
Sequence:CCGGGCGATCATCATGGACACAGTTCTCGAGAACTGTGTCCATGATGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053122.2-956s1c1
Sequence:CCGGGCAGCAAAGATGATTTGTCTTCTCGAGAAGACAAATCATCTTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-611s1c1
Sequence:CCGGCACTCCAGACTGGTGAGAAATCTCGAGATTTCTCACCAGTCTGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-388s1c1
Sequence:CCGGGCTCTTGAAGGAGATATTGTACTCGAGTACAATATCTCCTTCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053122.2-321s1c1
Sequence:CCGGGCGTGGTGACATTGTGTCATTCTCGAGAATGACACAATGTCACCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)