EMAIL THIS PAGE TO A FRIEND

IMMT

inner membrane protein, mitochondrial

100 Gene Product Result for
Synonyms: HMP MINOS2 P87 P87/89 P89 PIG52
Gene ID:
Mouse(76614) inner membrane protein, mitochondrial
Rat(312444) inner membrane protein, mitochondrial
Zebrafish(327206) inner membrane protein, mitochondrial (mitofilin)
cow(508853) inner membrane protein, mitochondrial
Horse(100067027) inner membrane protein, mitochondrial
domestic cat(101087830) inner membrane protein, mitochondrial
dog(475764) inner membrane protein, mitochondrial
chicken(422912) inner membrane protein, mitochondrial
sheep(101105896) inner membrane protein, mitochondrial
Domestic Rabbit(100337704) inner membrane protein, mitochondrial
domestic guinea pig(100728046) inner membrane protein, mitochondrial
naked mole-rat(101726109) inner membrane protein, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006839 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100169 Rosetta Predictions human pricing
NM_001100170 Rosetta Predictions human pricing
NM_006839 Rosetta Predictions human pricing
NM_001034928 Rosetta Predictions rat pricing
NM_029673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321814 predicted 2143
2 SASI_Hs02_00321815 predicted 2284
3 SASI_Hs02_00321816 predicted 1706
4 SASI_Hs02_00321817 predicted 2108
5 SASI_Hs02_00321818 predicted 2091
6 SASI_Hs02_00321819 predicted 564
7 SASI_Hs02_00321820 predicted 1535
8 SASI_Hs02_00321821 predicted 425
9 SASI_Hs02_00321822 predicted 2331
10 SASI_Hs02_00321823 predicted 2036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321824 predicted 2111
2 SASI_Hs02_00321825 predicted 2253
3 SASI_Hs02_00321826 predicted 1674
4 SASI_Hs02_00321827 predicted 2076
5 SASI_Hs02_00321828 predicted 2059
6 SASI_Hs02_00321829 predicted 561
7 SASI_Hs02_00321830 predicted 1502
8 SASI_Hs02_00321831 predicted 427
9 SASI_Hs02_00321832 predicted 2305
10 SASI_Hs02_00321833 predicted 2005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080616 predicted 2143
2 SASI_Hs02_00342410 predicted 2287
3 SASI_Hs02_00342411 predicted 1716
4 SASI_Hs02_00342412 predicted 2111
5 SASI_Hs01_00080617 predicted 2096
6 SASI_Hs02_00342413 predicted 564
7 SASI_Hs01_00080615 predicted 1537
8 SASI_Hs02_00342414 predicted 426
9 SASI_Hs02_00342415 predicted 2339
10 SASI_Hs02_00342416 predicted 2037
11 SASI_Hs01_00080618 predicted 398
12 SASI_Hs01_00080619 predicted 799
13 SASI_Hs01_00080620 predicted 515
14 SASI_Hs01_00080621 predicted 331
15 SASI_Hs01_00080622 predicted 653
16 SASI_Hs01_00080623 predicted 838
17 SASI_Hs01_00080624 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069317 predicted 1518
2 SASI_Rn01_00069318 predicted 1564
3 SASI_Rn01_00069320 predicted 319
4 SASI_Rn01_00069321 predicted 417
5 SASI_Rn01_00069322 predicted 543
6 SASI_Rn01_00069323 predicted 255
7 SASI_Rn01_00069324 predicted 383
8 SASI_Rn02_00204097 predicted 1592
9 SASI_Rn01_00069325 predicted 1400
10 SASI_Rn01_00069326 predicted 1014
11 SASI_Rn01_00069319 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098273 predicted 379
2 SASI_Mm01_00098274 predicted 1604
3 SASI_Mm01_00098275 predicted 1842
4 SASI_Mm01_00098276 predicted 2419
5 SASI_Mm01_00098277 predicted 318
6 SASI_Mm01_00098279 predicted 1926
7 SASI_Mm01_00098280 predicted 223
8 SASI_Mm01_00098281 predicted 731
9 SASI_Mm01_00098282 predicted 257
10 SASI_Mm02_00335696 predicted 449
11 SASI_Mm01_00098278 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029673
VALIDATED
IMMT MISSION shRNA Bacterial Glycerol Stock
inner membrane protein, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-1314s21c1
Sequence:CCGGGCTGGCAAACTCTCTACTGATCTCGAGATCAGTAGAGAGTTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-2035s21c1
Sequence:CCGGCCCGTTTCTATGCTGTTCAAACTCGAGTTTGAACAGCATAGAAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029673.2-2561s21c1
Sequence:CCGGCCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-2098s21c1
Sequence:CCGGGCCTGTACCAATACTTCCTTTCTCGAGAAAGGAAGTATTGGTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-888s21c1
Sequence:CCGGGCACACTCCAACATACTGAAACTCGAGTTTCAGTATGTTGGAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2098s1c1
Sequence:CCGGGCCTGTACCAATACTTCCTTTCTCGAGAAAGGAAGTATTGGTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-888s1c1
Sequence:CCGGGCACACTCCAACATACTGAAACTCGAGTTTCAGTATGTTGGAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-1314s1c1
Sequence:CCGGGCTGGCAAACTCTCTACTGATCTCGAGATCAGTAGAGAGTTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2035s1c1
Sequence:CCGGCCCGTTTCTATGCTGTTCAAACTCGAGTTTGAACAGCATAGAAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2561s1c1
Sequence:CCGGCCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029673
VALIDATED
IMMT MISSION shRNA shRNA Plasmid DNA
inner membrane protein, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-1314s21c1
Sequence:CCGGGCTGGCAAACTCTCTACTGATCTCGAGATCAGTAGAGAGTTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-2035s21c1
Sequence:CCGGCCCGTTTCTATGCTGTTCAAACTCGAGTTTGAACAGCATAGAAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029673.2-2561s21c1
Sequence:CCGGCCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-2098s21c1
Sequence:CCGGGCCTGTACCAATACTTCCTTTCTCGAGAAAGGAAGTATTGGTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-888s21c1
Sequence:CCGGGCACACTCCAACATACTGAAACTCGAGTTTCAGTATGTTGGAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2098s1c1
Sequence:CCGGGCCTGTACCAATACTTCCTTTCTCGAGAAAGGAAGTATTGGTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-888s1c1
Sequence:CCGGGCACACTCCAACATACTGAAACTCGAGTTTCAGTATGTTGGAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-1314s1c1
Sequence:CCGGGCTGGCAAACTCTCTACTGATCTCGAGATCAGTAGAGAGTTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2035s1c1
Sequence:CCGGCCCGTTTCTATGCTGTTCAAACTCGAGTTTGAACAGCATAGAAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2561s1c1
Sequence:CCGGCCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029673
VALIDATED
IMMT MISSION shRNA Lentiviral Transduction Particles
inner membrane protein, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-1314s21c1
Sequence:CCGGGCTGGCAAACTCTCTACTGATCTCGAGATCAGTAGAGAGTTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-2035s21c1
Sequence:CCGGCCCGTTTCTATGCTGTTCAAACTCGAGTTTGAACAGCATAGAAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029673.2-2561s21c1
Sequence:CCGGCCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-2098s21c1
Sequence:CCGGGCCTGTACCAATACTTCCTTTCTCGAGAAAGGAAGTATTGGTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029673.2-888s21c1
Sequence:CCGGGCACACTCCAACATACTGAAACTCGAGTTTCAGTATGTTGGAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2098s1c1
Sequence:CCGGGCCTGTACCAATACTTCCTTTCTCGAGAAAGGAAGTATTGGTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-888s1c1
Sequence:CCGGGCACACTCCAACATACTGAAACTCGAGTTTCAGTATGTTGGAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-1314s1c1
Sequence:CCGGGCTGGCAAACTCTCTACTGATCTCGAGATCAGTAGAGAGTTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2035s1c1
Sequence:CCGGCCCGTTTCTATGCTGTTCAAACTCGAGTTTGAACAGCATAGAAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029673.2-2561s1c1
Sequence:CCGGCCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006839
VALIDATED
IMMT MISSION shRNA Bacterial Glycerol Stock
inner membrane protein, mitochondrial
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1919s1c1
Sequence:CCGGCCAAGCTTTAACCGCAGCTATCTCGAGATAGCTGCGGTTAAAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1146s1c1
Sequence:CCGGGCTAAGGTTGTATCTCAGTATCTCGAGATACTGAGATACAACCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006839.1-2045s1c1
Sequence:CCGGCAGAAATAGCTTGTACCAGTACTCGAGTACTGGTACAAGCTATTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006839.1-2406s1c1
Sequence:CCGGCAAAGGAAATCAGCAGTGATACTCGAGTATCACTGCTGATTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-2459s1c1
Sequence:CCGGGTCTAGAAATGAGCAGGTTTACTCGAGTAAACCTGCTCATTTCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1240s1c1
Sequence:CCGGGATGGAAAGGAATGAGTGTTTCTCGAGAAACACTCATTCCTTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-271s1c1
Sequence:CCGGGCACTATCCTATATGCCAAATCTCGAGATTTGGCATATAGGATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006839
VALIDATED
IMMT MISSION shRNA shRNA Plasmid DNA
inner membrane protein, mitochondrial
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1919s1c1
Sequence:CCGGCCAAGCTTTAACCGCAGCTATCTCGAGATAGCTGCGGTTAAAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1146s1c1
Sequence:CCGGGCTAAGGTTGTATCTCAGTATCTCGAGATACTGAGATACAACCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006839.1-2045s1c1
Sequence:CCGGCAGAAATAGCTTGTACCAGTACTCGAGTACTGGTACAAGCTATTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006839.1-2406s1c1
Sequence:CCGGCAAAGGAAATCAGCAGTGATACTCGAGTATCACTGCTGATTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-2459s1c1
Sequence:CCGGGTCTAGAAATGAGCAGGTTTACTCGAGTAAACCTGCTCATTTCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1240s1c1
Sequence:CCGGGATGGAAAGGAATGAGTGTTTCTCGAGAAACACTCATTCCTTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-271s1c1
Sequence:CCGGGCACTATCCTATATGCCAAATCTCGAGATTTGGCATATAGGATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006839
VALIDATED
IMMT MISSION shRNA Lentiviral Transduction Particles
inner membrane protein, mitochondrial
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1919s1c1
Sequence:CCGGCCAAGCTTTAACCGCAGCTATCTCGAGATAGCTGCGGTTAAAGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1146s1c1
Sequence:CCGGGCTAAGGTTGTATCTCAGTATCTCGAGATACTGAGATACAACCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006839.1-2045s1c1
Sequence:CCGGCAGAAATAGCTTGTACCAGTACTCGAGTACTGGTACAAGCTATTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006839.1-2406s1c1
Sequence:CCGGCAAAGGAAATCAGCAGTGATACTCGAGTATCACTGCTGATTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-2459s1c1
Sequence:CCGGGTCTAGAAATGAGCAGGTTTACTCGAGTAAACCTGCTCATTTCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-1240s1c1
Sequence:CCGGGATGGAAAGGAATGAGTGTTTCTCGAGAAACACTCATTCCTTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006839.1-271s1c1
Sequence:CCGGGCACTATCCTATATGCCAAATCTCGAGATTTGGCATATAGGATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)