EMAIL THIS PAGE TO A FRIEND

IMP3

IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)

41 Gene Product Result for
Synonyms: BRMS2 C15orf12 MRPS4
UniProtKB ID: Q9NV31, B3KQ67, Q53G10
Gene ID:
Human(55272) Summary: This gene encodes the human homolog of the yeast Imp3 protein. The protein localizes to the nucleoli and interacts with the U3 snoRNP complex. The protein contains an S4 domain. [provided by RefSeq, Jul 2008]
Mouse(102462) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Rat(315697) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
sheep(101117969) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
domestic guinea pig(100723789) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
naked mole-rat(101719258) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Zebrafish(393237) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
cow(511560) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
domestic cat(101097730) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
dog(487656) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
chicken(771480) IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018285 Rosetta Predictions human pricing
NM_001108152 Rosetta Predictions rat pricing
NM_133976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159803 predicted 893
2 SASI_Hs01_00159804 predicted 304
3 SASI_Hs01_00159805 predicted 202
4 SASI_Hs01_00159806 predicted 329
5 SASI_Hs01_00159807 predicted 209
6 SASI_Hs01_00159808 predicted 267
7 SASI_Hs01_00159809 predicted 353
8 SASI_Hs01_00159810 predicted 378
9 SASI_Hs01_00159811 predicted 385
10 SASI_Hs01_00159812 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235874 predicted 563
2 SASI_Rn02_00235875 predicted 638
3 SASI_Rn02_00235876 predicted 567
4 SASI_Rn02_00235877 predicted 438
5 SASI_Rn02_00235878 predicted 536
6 SASI_Rn02_00235879 predicted 656
7 SASI_Rn02_00235880 predicted 235
8 SASI_Rn02_00235881 predicted 483
9 SASI_Rn02_00235882 predicted 447
10 SASI_Rn02_00235883 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056196 predicted 537
2 SASI_Mm01_00056197 predicted 533
3 SASI_Mm01_00056199 predicted 337
4 SASI_Mm01_00056201 predicted 534
5 SASI_Mm01_00056202 predicted 653
6 SASI_Mm01_00056203 predicted 642
7 SASI_Mm01_00056204 predicted 637
8 SASI_Mm01_00056205 predicted 669
9 SASI_Mm02_00339099 predicted 480
10 SASI_Mm02_00339100 predicted 429
11 SASI_Mm01_00056198 predicted 451
12 SASI_Mm01_00056200 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018285
VALIDATED
IMP3 MISSION shRNA Bacterial Glycerol Stock
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018285.1-505s1c1
Sequence:CCGGGCATGGAGGACTTTGTCACTTCTCGAGAAGTGACAAAGTCCTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-611s1c1
Sequence:CCGGCCACTTTGCATGGCTGTCTTTCTCGAGAAAGACAGCCATGCAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-824s1c1
Sequence:CCGGCTTGGGAAACAGTGGGAAGTACTCGAGTACTTCCCACTGTTTCCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-588s21c1
Sequence:CCGGCGGCACGTGCTAGAGTACAATCTCGAGATTGTACTCTAGCACGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-695s1c1
Sequence:CCGGCAGACGGTCGTAGGTTCTTAACTCGAGTTAAGAACCTACGACCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018285.1-651s1c1
Sequence:CCGGGCCTGATGCTGGAGATTCTATCTCGAGATAGAATCTCCAGCATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-927s1c1
Sequence:CCGGCCTGTTTCCCTTTATCGTCTTCTCGAGAAGACGATAAAGGGAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-872s1c1
Sequence:CCGGGCTTCTTGTGTTGGAAACTTTCTCGAGAAAGTTTCCAACACAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-911s21c1
Sequence:CCGGGCTTCTTGTGTTGGAAACTTTCTCGAGAAAGTTTCCAACACAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-734s21c1
Sequence:CCGGCAGACGGTCGTAGGTTCTTAACTCGAGTTAAGAACCTACGACCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-863s21c1
Sequence:CCGGCTTGGGAAACAGTGGGAAGTACTCGAGTACTTCCCACTGTTTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018285
VALIDATED
IMP3 MISSION shRNA shRNA Plasmid DNA
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018285.1-505s1c1
Sequence:CCGGGCATGGAGGACTTTGTCACTTCTCGAGAAGTGACAAAGTCCTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-611s1c1
Sequence:CCGGCCACTTTGCATGGCTGTCTTTCTCGAGAAAGACAGCCATGCAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-824s1c1
Sequence:CCGGCTTGGGAAACAGTGGGAAGTACTCGAGTACTTCCCACTGTTTCCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-588s21c1
Sequence:CCGGCGGCACGTGCTAGAGTACAATCTCGAGATTGTACTCTAGCACGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-695s1c1
Sequence:CCGGCAGACGGTCGTAGGTTCTTAACTCGAGTTAAGAACCTACGACCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018285.1-651s1c1
Sequence:CCGGGCCTGATGCTGGAGATTCTATCTCGAGATAGAATCTCCAGCATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-927s1c1
Sequence:CCGGCCTGTTTCCCTTTATCGTCTTCTCGAGAAGACGATAAAGGGAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-872s1c1
Sequence:CCGGGCTTCTTGTGTTGGAAACTTTCTCGAGAAAGTTTCCAACACAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-911s21c1
Sequence:CCGGGCTTCTTGTGTTGGAAACTTTCTCGAGAAAGTTTCCAACACAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-734s21c1
Sequence:CCGGCAGACGGTCGTAGGTTCTTAACTCGAGTTAAGAACCTACGACCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-863s21c1
Sequence:CCGGCTTGGGAAACAGTGGGAAGTACTCGAGTACTTCCCACTGTTTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018285
VALIDATED
IMP3 MISSION shRNA Lentiviral Transduction Particles
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018285.1-505s1c1
Sequence:CCGGGCATGGAGGACTTTGTCACTTCTCGAGAAGTGACAAAGTCCTCCATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-611s1c1
Sequence:CCGGCCACTTTGCATGGCTGTCTTTCTCGAGAAAGACAGCCATGCAAAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-824s1c1
Sequence:CCGGCTTGGGAAACAGTGGGAAGTACTCGAGTACTTCCCACTGTTTCCCAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-588s21c1
Sequence:CCGGCGGCACGTGCTAGAGTACAATCTCGAGATTGTACTCTAGCACGTGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-695s1c1
Sequence:CCGGCAGACGGTCGTAGGTTCTTAACTCGAGTTAAGAACCTACGACCGTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018285.1-651s1c1
Sequence:CCGGGCCTGATGCTGGAGATTCTATCTCGAGATAGAATCTCCAGCATCAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-927s1c1
Sequence:CCGGCCTGTTTCCCTTTATCGTCTTCTCGAGAAGACGATAAAGGGAAACAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018285.1-872s1c1
Sequence:CCGGGCTTCTTGTGTTGGAAACTTTCTCGAGAAAGTTTCCAACACAAGAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-911s21c1
Sequence:CCGGGCTTCTTGTGTTGGAAACTTTCTCGAGAAAGTTTCCAACACAAGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-734s21c1
Sequence:CCGGCAGACGGTCGTAGGTTCTTAACTCGAGTTAAGAACCTACGACCGTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018285.2-863s21c1
Sequence:CCGGCTTGGGAAACAGTGGGAAGTACTCGAGTACTTCCCACTGTTTCCCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133976
VALIDATED
IMP3 MISSION shRNA Bacterial Glycerol Stock
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-474s21c1
Sequence:CCGGACTTTGTCACCTGGGTGGACTCTCGAGAGTCCACCCAGGTGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133976.1-648s1c1
Sequence:CCGGCCTAGAATTTGGACTGACAATCTCGAGATTGTCAGTCCAAATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-344s1c1
Sequence:CCGGCCTACTTTGCTCCTCAAGCTACTCGAGTAGCTTGAGGAGCAAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-56s1c1
Sequence:CCGGGTGGACTTCCTAAACTGGGAACTCGAGTTCCCAGTTTAGGAAGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-136s1c1
Sequence:CCGGCGAGGAGTACACGCGCTACAACTCGAGTTGTAGCGCGTGTACTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-536s1c1
Sequence:CCGGGAGCGCGATGACTTTGATCTACTCGAGTAGATCAAAGTCATCGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-535s21c1
Sequence:CCGGGCGCGATGACTTTGATCTAGACTCGAGTCTAGATCAAAGTCATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-552s21c1
Sequence:CCGGTAGATGCCTAGCGAGTCTTCTCTCGAGAGAAGACTCGCTAGGCATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-510s21c1
Sequence:CCGGGGCACGTGTTGGAGTACAATGCTCGAGCATTGTACTCCAACACGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-395s21c1
Sequence:CCGGTTTGTGGAGCAGGGTCATGTCCTCGAGGACATGACCCTGCTCCACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-339s21c1
Sequence:CCGGTGCCTACTTTGCTCCTCAAGCCTCGAGGCTTGAGGAGCAAAGTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-245s21c1
Sequence:CCGGTTGGACAAGCTGTACGCTATGCTCGAGCATAGCGTACAGCTTGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133976
VALIDATED
IMP3 MISSION shRNA shRNA Plasmid DNA
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-474s21c1
Sequence:CCGGACTTTGTCACCTGGGTGGACTCTCGAGAGTCCACCCAGGTGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133976.1-648s1c1
Sequence:CCGGCCTAGAATTTGGACTGACAATCTCGAGATTGTCAGTCCAAATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-344s1c1
Sequence:CCGGCCTACTTTGCTCCTCAAGCTACTCGAGTAGCTTGAGGAGCAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-56s1c1
Sequence:CCGGGTGGACTTCCTAAACTGGGAACTCGAGTTCCCAGTTTAGGAAGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-136s1c1
Sequence:CCGGCGAGGAGTACACGCGCTACAACTCGAGTTGTAGCGCGTGTACTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-536s1c1
Sequence:CCGGGAGCGCGATGACTTTGATCTACTCGAGTAGATCAAAGTCATCGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-535s21c1
Sequence:CCGGGCGCGATGACTTTGATCTAGACTCGAGTCTAGATCAAAGTCATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-552s21c1
Sequence:CCGGTAGATGCCTAGCGAGTCTTCTCTCGAGAGAAGACTCGCTAGGCATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-510s21c1
Sequence:CCGGGGCACGTGTTGGAGTACAATGCTCGAGCATTGTACTCCAACACGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-395s21c1
Sequence:CCGGTTTGTGGAGCAGGGTCATGTCCTCGAGGACATGACCCTGCTCCACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-339s21c1
Sequence:CCGGTGCCTACTTTGCTCCTCAAGCCTCGAGGCTTGAGGAGCAAAGTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-245s21c1
Sequence:CCGGTTGGACAAGCTGTACGCTATGCTCGAGCATAGCGTACAGCTTGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133976
VALIDATED
IMP3 MISSION shRNA Lentiviral Transduction Particles
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-474s21c1
Sequence:CCGGACTTTGTCACCTGGGTGGACTCTCGAGAGTCCACCCAGGTGACAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000099715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133976.1-648s1c1
Sequence:CCGGCCTAGAATTTGGACTGACAATCTCGAGATTGTCAGTCCAAATTCTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000099717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-344s1c1
Sequence:CCGGCCTACTTTGCTCCTCAAGCTACTCGAGTAGCTTGAGGAGCAAAGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000099719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-56s1c1
Sequence:CCGGGTGGACTTCCTAAACTGGGAACTCGAGTTCCCAGTTTAGGAAGTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000099718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-136s1c1
Sequence:CCGGCGAGGAGTACACGCGCTACAACTCGAGTTGTAGCGCGTGTACTCCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000099716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133976.1-536s1c1
Sequence:CCGGGAGCGCGATGACTTTGATCTACTCGAGTAGATCAAAGTCATCGCGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-535s21c1
Sequence:CCGGGCGCGATGACTTTGATCTAGACTCGAGTCTAGATCAAAGTCATCGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-552s21c1
Sequence:CCGGTAGATGCCTAGCGAGTCTTCTCTCGAGAGAAGACTCGCTAGGCATCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-510s21c1
Sequence:CCGGGGCACGTGTTGGAGTACAATGCTCGAGCATTGTACTCCAACACGTGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-395s21c1
Sequence:CCGGTTTGTGGAGCAGGGTCATGTCCTCGAGGACATGACCCTGCTCCACAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133976.2-339s21c1
Sequence:CCGGTGCCTACTTTGCTCCTCAAGCCTCGAGGCTTGAGGAGCAAAGTAGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133976.2-245s21c1
Sequence:CCGGTTGGACAAGCTGTACGCTATGCTCGAGCATAGCGTACAGCTTGTCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???