EMAIL THIS PAGE TO A FRIEND

IMPA1

inositol(myo)-1(or 4)-monophosphatase 1

82 Gene Product Result for
Synonyms: IMP IMPA
UniProtKB ID: P29218, B2R733, B4DLN3, B7Z6Q4, J3KQT7, Q9UK71
Gene ID:
Human(3612) Summary: This gene encodes an enyzme that dephosphorylates myo-inositol monophosphate to generate free myo-inositol, a precursor of phosphatidylinositol, and is therefore an important modulator of intracellular signal transduction via the production of the second messengers myoinositol 1,4,5-trisphosphate and diacylglycerol. This enzyme can also use myo-inositol-1,3-diphosphate, myo-inositol-1,4-diphosphate, scyllo-inositol-phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1-phosphate, beta-glycerophosphate, and 2'-AMP as substrates. This enzyme shows magnesium-dependent phosphatase activity and is inhibited by therapeutic concentrations of lithium. Inhibition of inositol monophosphate hydroylosis and subsequent depletion of inositol for phosphatidylinositol synthesis may explain the anti-manic and anti-depressive effects of lithium administered to treat bipolar disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. A pseudogene of this gene is also present on chromosome 8q21.13. [provided by RefSeq, Nov 2009]
Mouse(55980) inositol (myo)-1(or 4)-monophosphatase 1
Rat(83523) Inositol (myo)-1(or 4)-monophosphatase 1
Zebrafish(437018) inositol(myo)-1(or 4)-monophosphatase 1
chicken(420199) inositol(myo)-1(or 4)-monophosphatase 1
dog(477925) inositol(myo)-1(or 4)-monophosphatase 1
domestic cat(101088214) inositol(myo)-1(or 4)-monophosphatase 1
cow(281865) inositol(myo)-1(or 4)-monophosphatase 1
sheep(101119912) inositol(myo)-1(or 4)-monophosphatase 1
domestic guinea pig(100723610) inositol(myo)-1(or 4)-monophosphatase 1
naked mole-rat(101704416) inositol(myo)-1(or 4)-monophosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005536 Rosetta Predictions human pricing
NM_032057 Rosetta Predictions rat pricing
NM_018864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198599 predicted 356
2 SASI_Hs01_00198600 predicted 1005
3 SASI_Hs02_00339772 predicted 363
4 SASI_Hs01_00198601 predicted 680
5 SASI_Hs01_00198602 predicted 665
6 SASI_Hs01_00198604 predicted 840
7 SASI_Hs02_00339773 predicted 444
8 SASI_Hs01_00198606 predicted 978
9 SASI_Hs01_00198607 predicted 884
10 SASI_Hs01_00198608 predicted 894
11 SASI_Hs01_00198603 predicted 385
12 SASI_Hs01_00198605 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031458 predicted 337
2 SASI_Rn01_00031459 predicted 384
3 SASI_Rn01_00031460 predicted 322
4 SASI_Rn01_00031461 predicted 1256
5 SASI_Rn01_00031462 predicted 348
6 SASI_Rn01_00031464 predicted 1399
7 SASI_Rn01_00031465 predicted 585
8 SASI_Rn02_00265398 predicted 1392
9 SASI_Rn02_00265399 predicted 262
10 SASI_Rn02_00265400 predicted 747
11 SASI_Rn01_00031456 predicted 451
12 SASI_Rn01_00031457 predicted 1410
13 SASI_Rn01_00031463 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324239 predicted 382
2 SASI_Mm01_00101086 predicted 575
3 SASI_Mm01_00101087 predicted 777
4 SASI_Mm01_00101088 predicted 643
5 SASI_Mm01_00101089 predicted 347
6 SASI_Mm01_00101090 predicted 1232
7 SASI_Mm01_00101091 predicted 1365
8 SASI_Mm01_00101092 predicted 1343
9 SASI_Mm01_00101094 predicted 1228
10 SASI_Mm01_00101095 predicted 632
11 SASI_Mm01_00101093 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005536
VALIDATED
IMPA1 MISSION shRNA Bacterial Glycerol Stock
inositol(myo)-1(or 4)-monophosphatase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-941s21c1
Sequence:CCGGCAACGAGACGACGAAGATTAACTCGAGTTAATCTTCGTCGTCTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-368s1c1
Sequence:CCGGCCCTATTGATGGAACAACTAACTCGAGTTAGTTGTTCCATCAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-768s1c1
Sequence:CCGGGCTGGCATTATTGTTACTGAACTCGAGTTCAGTAACAATAATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005536.2-132s1c1
Sequence:CCGGGCAGTAACTCTAGCAAGACAACTCGAGTTGTCTTGCTAGAGTTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-684s1c1
Sequence:CCGGGCAGCTGTTAATATGTGCCTTCTCGAGAAGGCACATATTAACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-840s1c1
Sequence:CCGGCGAAGAGTAATTGCTGCAAATCTCGAGATTTGCAGCAATTACTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-788s21c1
Sequence:GTACCGGGTTGCAGGAGCTGGCATTATTCTCGAGAATAATGCCAGCTCCTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-814s21c1
Sequence:GTACCGGTGAAGCTGGTGGCGTGCTAATCTCGAGATTAGCACGCCACCAGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005536.3-383s21c1
Sequence:GTACCGGACATGGATCATTGACCCTATTCTCGAGAATAGGGTCAATGATCCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-161s21c1
Sequence:CCGGGCAGTAACTCTAGCAAGACAACTCGAGTTGTCTTGCTAGAGTTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-190s21c1
Sequence:CCGGGGTAGTTTGTGAAGCTATAAACTCGAGTTTATAGCTTCACAAACTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-1218s21c1
Sequence:CCGGCATCAACTGAAATAGTCAATTCTCGAGAATTGACTATTTCAGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-742s21c1
Sequence:CCGGTGGCGGAGCAGATGCATATTACTCGAGTAATATGCATCTGCTCCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-1038s21c1
Sequence:GTACCGGGTATGATATGCTTGGTTTAAACTCGAGTTTAAACCAAGCATATCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005536
VALIDATED
IMPA1 MISSION shRNA shRNA Plasmid DNA
inositol(myo)-1(or 4)-monophosphatase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-941s21c1
Sequence:CCGGCAACGAGACGACGAAGATTAACTCGAGTTAATCTTCGTCGTCTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-368s1c1
Sequence:CCGGCCCTATTGATGGAACAACTAACTCGAGTTAGTTGTTCCATCAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-768s1c1
Sequence:CCGGGCTGGCATTATTGTTACTGAACTCGAGTTCAGTAACAATAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005536.2-132s1c1
Sequence:CCGGGCAGTAACTCTAGCAAGACAACTCGAGTTGTCTTGCTAGAGTTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-684s1c1
Sequence:CCGGGCAGCTGTTAATATGTGCCTTCTCGAGAAGGCACATATTAACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-840s1c1
Sequence:CCGGCGAAGAGTAATTGCTGCAAATCTCGAGATTTGCAGCAATTACTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-788s21c1
Sequence:GTACCGGGTTGCAGGAGCTGGCATTATTCTCGAGAATAATGCCAGCTCCTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-814s21c1
Sequence:GTACCGGTGAAGCTGGTGGCGTGCTAATCTCGAGATTAGCACGCCACCAGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005536.3-383s21c1
Sequence:GTACCGGACATGGATCATTGACCCTATTCTCGAGAATAGGGTCAATGATCCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-161s21c1
Sequence:CCGGGCAGTAACTCTAGCAAGACAACTCGAGTTGTCTTGCTAGAGTTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-190s21c1
Sequence:CCGGGGTAGTTTGTGAAGCTATAAACTCGAGTTTATAGCTTCACAAACTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-1218s21c1
Sequence:CCGGCATCAACTGAAATAGTCAATTCTCGAGAATTGACTATTTCAGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-742s21c1
Sequence:CCGGTGGCGGAGCAGATGCATATTACTCGAGTAATATGCATCTGCTCCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-1038s21c1
Sequence:GTACCGGGTATGATATGCTTGGTTTAAACTCGAGTTTAAACCAAGCATATCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005536
VALIDATED
IMPA1 MISSION shRNA Lentiviral Transduction Particles
inositol(myo)-1(or 4)-monophosphatase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-941s21c1
Sequence:CCGGCAACGAGACGACGAAGATTAACTCGAGTTAATCTTCGTCGTCTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-368s1c1
Sequence:CCGGCCCTATTGATGGAACAACTAACTCGAGTTAGTTGTTCCATCAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-768s1c1
Sequence:CCGGGCTGGCATTATTGTTACTGAACTCGAGTTCAGTAACAATAATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005536.2-132s1c1
Sequence:CCGGGCAGTAACTCTAGCAAGACAACTCGAGTTGTCTTGCTAGAGTTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-684s1c1
Sequence:CCGGGCAGCTGTTAATATGTGCCTTCTCGAGAAGGCACATATTAACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005536.2-840s1c1
Sequence:CCGGCGAAGAGTAATTGCTGCAAATCTCGAGATTTGCAGCAATTACTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-788s21c1
Sequence:GTACCGGGTTGCAGGAGCTGGCATTATTCTCGAGAATAATGCCAGCTCCTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-814s21c1
Sequence:GTACCGGTGAAGCTGGTGGCGTGCTAATCTCGAGATTAGCACGCCACCAGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005536.3-383s21c1
Sequence:GTACCGGACATGGATCATTGACCCTATTCTCGAGAATAGGGTCAATGATCCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-161s21c1
Sequence:CCGGGCAGTAACTCTAGCAAGACAACTCGAGTTGTCTTGCTAGAGTTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-190s21c1
Sequence:CCGGGGTAGTTTGTGAAGCTATAAACTCGAGTTTATAGCTTCACAAACTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-1218s21c1
Sequence:CCGGCATCAACTGAAATAGTCAATTCTCGAGAATTGACTATTTCAGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-742s21c1
Sequence:CCGGTGGCGGAGCAGATGCATATTACTCGAGTAATATGCATCTGCTCCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005536.3-1038s21c1
Sequence:GTACCGGGTATGATATGCTTGGTTTAAACTCGAGTTTAAACCAAGCATATCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018864
VALIDATED
IMPA1 MISSION shRNA Bacterial Glycerol Stock
inositol(myo)-1(or 4)-monophosphatase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-1222s21c1
Sequence:CCGGATGTTCCAGAAGCCATATTTGCTCGAGCAAATATGGCTTCTGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018864.5-908s21c1
Sequence:CCGGGCCAAAGAAATTGAGATAATACTCGAGTATTATCTCAATTTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-796s21c1
Sequence:CCGGCGGAGAATAATTGCCGCAAATCTCGAGATTTGCGGCAATTATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018864.3-2371s1c1
Sequence:CCGGCGTGGAATTAAAGGAGTAATTCTCGAGAATTACTCCTTTAATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-797s1c1
Sequence:CCGGCGGAGAATAATTGCCGCAAATCTCGAGATTTGCGGCAATTATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-110s1c1
Sequence:CCGGGCTGGAGAGATGATTCGTGAACTCGAGTTCACGAATCATCTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-641s1c1
Sequence:CCGGGCTGCTGTTAATATGTGCCTTCTCGAGAAGGCACATATTAACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018864.3-795s1c1
Sequence:CCGGCTCGGAGAATAATTGCCGCAACTCGAGTTGCGGCAATTATTCTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-325s21c1
Sequence:CCGGCCCATTGATGGAACGACTAACCTCGAGGTTAGTCGTTCCATCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.5-737s21c1
Sequence:CCGGGGAGGAGCAGATGCCTATTATCTCGAGATAATAGGCATCTGCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-109s21c1
Sequence:CCGGGCTGGAGAGATGATTCGTGAACTCGAGTTCACGAATCATCTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.5-1014s21c1
Sequence:CCGGTGGATGGTGTCACTGATTTAGCTCGAGCTAAATCAGTGACACCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-141s21c1
Sequence:CCGGTGAGATGGATGTCATGATTAACTCGAGTTAATCATGACATCCATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018864
VALIDATED
IMPA1 MISSION shRNA shRNA Plasmid DNA
inositol(myo)-1(or 4)-monophosphatase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-1222s21c1
Sequence:CCGGATGTTCCAGAAGCCATATTTGCTCGAGCAAATATGGCTTCTGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018864.5-908s21c1
Sequence:CCGGGCCAAAGAAATTGAGATAATACTCGAGTATTATCTCAATTTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-796s21c1
Sequence:CCGGCGGAGAATAATTGCCGCAAATCTCGAGATTTGCGGCAATTATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018864.3-2371s1c1
Sequence:CCGGCGTGGAATTAAAGGAGTAATTCTCGAGAATTACTCCTTTAATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-797s1c1
Sequence:CCGGCGGAGAATAATTGCCGCAAATCTCGAGATTTGCGGCAATTATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-110s1c1
Sequence:CCGGGCTGGAGAGATGATTCGTGAACTCGAGTTCACGAATCATCTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-641s1c1
Sequence:CCGGGCTGCTGTTAATATGTGCCTTCTCGAGAAGGCACATATTAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018864.3-795s1c1
Sequence:CCGGCTCGGAGAATAATTGCCGCAACTCGAGTTGCGGCAATTATTCTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-325s21c1
Sequence:CCGGCCCATTGATGGAACGACTAACCTCGAGGTTAGTCGTTCCATCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.5-737s21c1
Sequence:CCGGGGAGGAGCAGATGCCTATTATCTCGAGATAATAGGCATCTGCTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-109s21c1
Sequence:CCGGGCTGGAGAGATGATTCGTGAACTCGAGTTCACGAATCATCTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.5-1014s21c1
Sequence:CCGGTGGATGGTGTCACTGATTTAGCTCGAGCTAAATCAGTGACACCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-141s21c1
Sequence:CCGGTGAGATGGATGTCATGATTAACTCGAGTTAATCATGACATCCATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018864
VALIDATED
IMPA1 MISSION shRNA Lentiviral Transduction Particles
inositol(myo)-1(or 4)-monophosphatase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-1222s21c1
Sequence:CCGGATGTTCCAGAAGCCATATTTGCTCGAGCAAATATGGCTTCTGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018864.5-908s21c1
Sequence:CCGGGCCAAAGAAATTGAGATAATACTCGAGTATTATCTCAATTTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-796s21c1
Sequence:CCGGCGGAGAATAATTGCCGCAAATCTCGAGATTTGCGGCAATTATTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018864.3-2371s1c1
Sequence:CCGGCGTGGAATTAAAGGAGTAATTCTCGAGAATTACTCCTTTAATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-797s1c1
Sequence:CCGGCGGAGAATAATTGCCGCAAATCTCGAGATTTGCGGCAATTATTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-110s1c1
Sequence:CCGGGCTGGAGAGATGATTCGTGAACTCGAGTTCACGAATCATCTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018864.3-641s1c1
Sequence:CCGGGCTGCTGTTAATATGTGCCTTCTCGAGAAGGCACATATTAACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018864.3-795s1c1
Sequence:CCGGCTCGGAGAATAATTGCCGCAACTCGAGTTGCGGCAATTATTCTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-325s21c1
Sequence:CCGGCCCATTGATGGAACGACTAACCTCGAGGTTAGTCGTTCCATCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.5-737s21c1
Sequence:CCGGGGAGGAGCAGATGCCTATTATCTCGAGATAATAGGCATCTGCTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-109s21c1
Sequence:CCGGGCTGGAGAGATGATTCGTGAACTCGAGTTCACGAATCATCTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.5-1014s21c1
Sequence:CCGGTGGATGGTGTCACTGATTTAGCTCGAGCTAAATCAGTGACACCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018864.4-141s21c1
Sequence:CCGGTGAGATGGATGTCATGATTAACTCGAGTTAATCATGACATCCATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)