EMAIL THIS PAGE TO A FRIEND

IMPA2

inositol(myo)-1(or 4)-monophosphatase 2

67 Gene Product Result for
UniProtKB ID: O14732, B0YJ29, Q9UJT3
Gene ID:
Human(3613) Summary: This locus encodes an inositol monophosphatase. The encoded protein catalyzes the dephosphoylration of inositol monophosphate and plays an important role in phosphatidylinositol signaling. This locus may be associated with susceptibility to bipolar disorder. [provided by RefSeq, Jan 2011]
Mouse(114663) inositol (myo)-1(or 4)-monophosphatase 2
Rat(282636) inositol (myo)-1(or 4)-monophosphatase 2
Zebrafish(553595) inositol(myo)-1(or 4)-monophosphatase 2
domestic cat(101098585) inositol(myo)-1(or 4)-monophosphatase 2
cow(511124) inositol(myo)-1(or 4)-monophosphatase 2
dog(608801) inositol(myo)-1(or 4)-monophosphatase 2
chicken(421032) inositol(myo)-1(or 4)-monophosphatase 2
domestic guinea pig(100734042) inositol(myo)-1(or 4)-monophosphatase 2
naked mole-rat(101719152) inositol(myo)-1(or 4)-monophosphatase 2
sheep(101105968) inositol(myo)-1(or 4)-monophosphatase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014214 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015161 MISSION® esiRNA esiRNA targeting mouse Impa2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014214 siRNAs that have been validated in the lab human pricing
NM_172224 Rosetta Predictions rat pricing
NM_053261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014214 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221523 validated 813
1 SASI_Hs01_00221522 validated 1214
1 SASI_Hs01_00221524 validated 367
2 SASI_Hs01_00221525 predicted 1032
3 SASI_Hs01_00221526 predicted 570
4 SASI_Hs01_00221527 predicted 551
5 SASI_Hs01_00221528 predicted 418
6 SASI_Hs01_00221530 predicted 561
7 SASI_Hs01_00221531 predicted 1046
8 SASI_Hs02_00345236 predicted 592
9 SASI_Hs01_00221529 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033521 predicted 359
2 SASI_Rn01_00033522 predicted 502
3 SASI_Rn01_00033523 predicted 838
4 SASI_Rn01_00033524 predicted 1056
5 SASI_Rn01_00033526 predicted 292
6 SASI_Rn01_00033527 predicted 563
7 SASI_Rn01_00033528 predicted 370
8 SASI_Rn01_00033529 predicted 734
9 SASI_Rn01_00033530 predicted 692
10 SASI_Rn02_00269198 predicted 504
11 SASI_Rn01_00033525 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061299 predicted 364
2 SASI_Mm01_00061300 predicted 1096
3 SASI_Mm01_00061301 predicted 341
4 SASI_Mm01_00061302 predicted 913
5 SASI_Mm01_00061304 predicted 727
6 SASI_Mm01_00061305 predicted 1000
7 SASI_Mm01_00061306 predicted 401
8 SASI_Mm01_00061307 predicted 654
9 SASI_Mm01_00061308 predicted 913
10 SASI_Mm02_00337892 predicted 402
11 SASI_Mm01_00061303 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014214
VALIDATED
IMPA2 MISSION shRNA Bacterial Glycerol Stock
inositol(myo)-1(or 4)-monophosphatase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014214.1-1200s21c1
Sequence:GTACCGGAGAGGGAGTTGTCACGCTACACTCGAGTGTAGCGTGACAACTCCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-1040s21c1
Sequence:CCGGGCCTTACAGACGATTAACTATCTCGAGATAGTTAATCGTCTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-362s21c1
Sequence:CCGGGCTGCAGATCTTGTGACAGAACTCGAGTTCTGTCACAAGATCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-760s21c1
Sequence:CCGGCCTGAAGCTGTTCCTGAGTAACTCGAGTTACTCAGGAACAGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-581s21c1
Sequence:CCGGGCTGTTCGACAAGAGCTTGAACTCGAGTTCAAGCTCTTGTCGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014214.1-1245s21c1
Sequence:GTACCGGACGTCTCTCTCACCAGGATTTCTCGAGAAATCCTGGTGAGAGAGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-760s1c1
Sequence:CCGGCCTGAAGCTGTTCCTGAGTAACTCGAGTTACTCAGGAACAGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-581s1c1
Sequence:CCGGGCTGTTCGACAAGAGCTTGAACTCGAGTTCAAGCTCTTGTCGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-917s1c1
Sequence:CCGGGCCACAGTCATCATCAGAGAACTCGAGTTCTCTGATGATGACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-362s1c1
Sequence:CCGGGCTGCAGATCTTGTGACAGAACTCGAGTTCTGTCACAAGATCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-1040s1c1
Sequence:CCGGGCCTTACAGACGATTAACTATCTCGAGATAGTTAATCGTCTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014214
VALIDATED
IMPA2 MISSION shRNA shRNA Plasmid DNA
inositol(myo)-1(or 4)-monophosphatase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014214.1-1200s21c1
Sequence:GTACCGGAGAGGGAGTTGTCACGCTACACTCGAGTGTAGCGTGACAACTCCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-1040s21c1
Sequence:CCGGGCCTTACAGACGATTAACTATCTCGAGATAGTTAATCGTCTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-362s21c1
Sequence:CCGGGCTGCAGATCTTGTGACAGAACTCGAGTTCTGTCACAAGATCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-760s21c1
Sequence:CCGGCCTGAAGCTGTTCCTGAGTAACTCGAGTTACTCAGGAACAGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-581s21c1
Sequence:CCGGGCTGTTCGACAAGAGCTTGAACTCGAGTTCAAGCTCTTGTCGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014214.1-1245s21c1
Sequence:GTACCGGACGTCTCTCTCACCAGGATTTCTCGAGAAATCCTGGTGAGAGAGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-760s1c1
Sequence:CCGGCCTGAAGCTGTTCCTGAGTAACTCGAGTTACTCAGGAACAGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-581s1c1
Sequence:CCGGGCTGTTCGACAAGAGCTTGAACTCGAGTTCAAGCTCTTGTCGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-917s1c1
Sequence:CCGGGCCACAGTCATCATCAGAGAACTCGAGTTCTCTGATGATGACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-362s1c1
Sequence:CCGGGCTGCAGATCTTGTGACAGAACTCGAGTTCTGTCACAAGATCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-1040s1c1
Sequence:CCGGGCCTTACAGACGATTAACTATCTCGAGATAGTTAATCGTCTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014214
VALIDATED
IMPA2 MISSION shRNA Lentiviral Transduction Particles
inositol(myo)-1(or 4)-monophosphatase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014214.1-1200s21c1
Sequence:GTACCGGAGAGGGAGTTGTCACGCTACACTCGAGTGTAGCGTGACAACTCCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-1040s21c1
Sequence:CCGGGCCTTACAGACGATTAACTATCTCGAGATAGTTAATCGTCTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-362s21c1
Sequence:CCGGGCTGCAGATCTTGTGACAGAACTCGAGTTCTGTCACAAGATCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-760s21c1
Sequence:CCGGCCTGAAGCTGTTCCTGAGTAACTCGAGTTACTCAGGAACAGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014214.1-581s21c1
Sequence:CCGGGCTGTTCGACAAGAGCTTGAACTCGAGTTCAAGCTCTTGTCGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014214.1-1245s21c1
Sequence:GTACCGGACGTCTCTCTCACCAGGATTTCTCGAGAAATCCTGGTGAGAGAGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-760s1c1
Sequence:CCGGCCTGAAGCTGTTCCTGAGTAACTCGAGTTACTCAGGAACAGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-581s1c1
Sequence:CCGGGCTGTTCGACAAGAGCTTGAACTCGAGTTCAAGCTCTTGTCGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-917s1c1
Sequence:CCGGGCCACAGTCATCATCAGAGAACTCGAGTTCTCTGATGATGACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-362s1c1
Sequence:CCGGGCTGCAGATCTTGTGACAGAACTCGAGTTCTGTCACAAGATCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014214.1-1040s1c1
Sequence:CCGGGCCTTACAGACGATTAACTATCTCGAGATAGTTAATCGTCTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053261
VALIDATED
IMPA2 MISSION shRNA Bacterial Glycerol Stock
inositol(myo)-1(or 4)-monophosphatase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-337s21c1
Sequence:CCGGCTGCCGATCTTGTGACAGAAACTCGAGTTTCTGTCACAAGATCGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-1167s21c1
Sequence:CCGGGCTTAGCTGATTCTCTCTAATCTCGAGATTAGAGAGAATCAGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-1004s21c1
Sequence:CCGGCATAGCTCAGGCCCTACAAACCTCGAGGTTTGTAGGGCCTGAGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-843s21c1
Sequence:CCGGGCCGACGCCTATTATCAGTTTCTCGAGAAACTGATAATAGGCGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-363s21c1
Sequence:CCGGCACCGAGTAGAAGATTTAATTCTCGAGAATTAAATCTTCTACTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-1166s1c1
Sequence:CCGGGCTTAGCTGATTCTCTCTAATCTCGAGATTAGAGAGAATCAGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053261.1-848s1c1
Sequence:CCGGGCCTATTATCAGTTTGGCCTTCTCGAGAAGGCCAAACTGATAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-336s1c1
Sequence:CCGGCTGCCGATCTTGTGACAGAAACTCGAGTTTCTGTCACAAGATCGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-842s1c1
Sequence:CCGGGCCGACGCCTATTATCAGTTTCTCGAGAAACTGATAATAGGCGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-362s1c1
Sequence:CCGGCACCGAGTAGAAGATTTAATTCTCGAGAATTAAATCTTCTACTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053261
VALIDATED
IMPA2 MISSION shRNA shRNA Plasmid DNA
inositol(myo)-1(or 4)-monophosphatase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-337s21c1
Sequence:CCGGCTGCCGATCTTGTGACAGAAACTCGAGTTTCTGTCACAAGATCGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-1167s21c1
Sequence:CCGGGCTTAGCTGATTCTCTCTAATCTCGAGATTAGAGAGAATCAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-1004s21c1
Sequence:CCGGCATAGCTCAGGCCCTACAAACCTCGAGGTTTGTAGGGCCTGAGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-843s21c1
Sequence:CCGGGCCGACGCCTATTATCAGTTTCTCGAGAAACTGATAATAGGCGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-363s21c1
Sequence:CCGGCACCGAGTAGAAGATTTAATTCTCGAGAATTAAATCTTCTACTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-1166s1c1
Sequence:CCGGGCTTAGCTGATTCTCTCTAATCTCGAGATTAGAGAGAATCAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053261.1-848s1c1
Sequence:CCGGGCCTATTATCAGTTTGGCCTTCTCGAGAAGGCCAAACTGATAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-336s1c1
Sequence:CCGGCTGCCGATCTTGTGACAGAAACTCGAGTTTCTGTCACAAGATCGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-842s1c1
Sequence:CCGGGCCGACGCCTATTATCAGTTTCTCGAGAAACTGATAATAGGCGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-362s1c1
Sequence:CCGGCACCGAGTAGAAGATTTAATTCTCGAGAATTAAATCTTCTACTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053261
VALIDATED
IMPA2 MISSION shRNA Lentiviral Transduction Particles
inositol(myo)-1(or 4)-monophosphatase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-337s21c1
Sequence:CCGGCTGCCGATCTTGTGACAGAAACTCGAGTTTCTGTCACAAGATCGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-1167s21c1
Sequence:CCGGGCTTAGCTGATTCTCTCTAATCTCGAGATTAGAGAGAATCAGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-1004s21c1
Sequence:CCGGCATAGCTCAGGCCCTACAAACCTCGAGGTTTGTAGGGCCTGAGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-843s21c1
Sequence:CCGGGCCGACGCCTATTATCAGTTTCTCGAGAAACTGATAATAGGCGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053261.2-363s21c1
Sequence:CCGGCACCGAGTAGAAGATTTAATTCTCGAGAATTAAATCTTCTACTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-1166s1c1
Sequence:CCGGGCTTAGCTGATTCTCTCTAATCTCGAGATTAGAGAGAATCAGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053261.1-848s1c1
Sequence:CCGGGCCTATTATCAGTTTGGCCTTCTCGAGAAGGCCAAACTGATAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-336s1c1
Sequence:CCGGCTGCCGATCTTGTGACAGAAACTCGAGTTTCTGTCACAAGATCGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-842s1c1
Sequence:CCGGGCCGACGCCTATTATCAGTTTCTCGAGAAACTGATAATAGGCGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053261.1-362s1c1
Sequence:CCGGCACCGAGTAGAAGATTTAATTCTCGAGAATTAAATCTTCTACTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)