EMAIL THIS PAGE TO A FRIEND

IMPACT

impact RWD domain protein

140 Gene Product Result for
Synonyms: RWDD5
UniProtKB ID: Q9P2X3, A8MXG0, Q49AM0, Q9H2X4
Gene ID:
Mouse(16210) imprinted and ancient
Rat(497198) imprinted and ancient
sheep(101118403) Impact homolog (mouse)
Domestic Rabbit(100009333) Impact homolog (mouse)
domestic guinea pig(100717578) impact RWD domain protein
naked mole-rat(101706042) impact RWD domain protein
Zebrafish(449553) Impact homolog (mouse)
cow(517248) Impact homolog (mouse)
domestic cat(101081680) Impact homolog (mouse)
dog(490513) Impact homolog (mouse)
chicken(421080) Impact homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018439 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026251 MISSION® esiRNA esiRNA human IMPACT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018439 Rosetta Predictions human pricing
NM_001012235 Rosetta Predictions rat pricing
NM_008378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084874 predicted 688
2 SASI_Hs01_00084875 predicted 1074
3 SASI_Hs01_00084876 predicted 484
4 SASI_Hs01_00084877 predicted 1079
5 SASI_Hs01_00084878 predicted 1016
6 SASI_Hs02_00351969 predicted 1056
7 SASI_Hs01_00084879 predicted 811
8 SASI_Hs01_00084880 predicted 932
9 SASI_Hs01_00084881 predicted 342
10 SASI_Hs01_00084882 predicted 510
11 SASI_Hs01_00084883 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117648 predicted 1014
2 SASI_Rn01_00117649 predicted 574
3 SASI_Rn01_00117650 predicted 320
4 SASI_Rn01_00117651 predicted 1025
5 SASI_Rn01_00117652 predicted 229
6 SASI_Rn01_00117653 predicted 415
7 SASI_Rn01_00117656 predicted 555
8 SASI_Rn01_00117657 predicted 290
9 SASI_Rn02_00200498 predicted 370
10 SASI_Rn02_00200499 predicted 849
11 SASI_Rn01_00117654 predicted 1058
12 SASI_Rn01_00117655 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119005 predicted 367
2 SASI_Mm01_00119006 predicted 495
3 SASI_Mm01_00119007 predicted 223
4 SASI_Mm01_00119008 predicted 320
5 SASI_Mm01_00119009 predicted 369
6 SASI_Mm01_00119010 predicted 965
7 SASI_Mm01_00119011 predicted 234
8 SASI_Mm01_00119012 predicted 577
9 SASI_Mm01_00119013 predicted 387
10 SASI_Mm01_00119014 predicted 1015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008378
VALIDATED
IMPACT MISSION shRNA Bacterial Glycerol Stock
impact RWD domain protein
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008378.1-491s1c1
Sequence:CCGGGAGTCCGAAGAAGACCCTATTCTCGAGAATAGGGTCTTCTTCGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008378.1-2214s1c1
Sequence:CCGGGCCAACAATGACTAAATTGATCTCGAGATCAATTTAGTCATTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008378.1-121s1c1
Sequence:CCGGGAGTGAAGAAATCGAAGCAATCTCGAGATTGCTTCGATTTCTTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008378.1-925s1c1
Sequence:CCGGCAACAACTGTGCCAGGAACATCTCGAGATGTTCCTGGCACAGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.1-373s1c1
Sequence:CCGGCATGGGTGAATCTATTCTTTACTCGAGTAAAGAATAGATTCACCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-690s21c1
Sequence:CCGGTTGCCAAGCTGTACGAGAATACTCGAGTATTCTCGTACAGCTTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-749s21c1
Sequence:CCGGAGGATATTCTGTGAGGATAAACTCGAGTTTATCCTCACAGAATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-971s21c1
Sequence:CCGGACTCCTGACGAGTCAACTAAGCTCGAGCTTAGTTGACTCGTCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-2203s21c1
Sequence:CCGGGCCAACAATGACTAAATTGATCTCGAGATCAATTTAGTCATTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-491s21c1
Sequence:CCGGGAGTCCGAAGAAGACCCTATTCTCGAGAATAGGGTCTTCTTCGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-227s1c1
Sequence:CCGGCCCAAATGGACACTTTGTTTACTCGAGTAAACAAAGTGTCCATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-748s1c1
Sequence:CCGGCAGGATATTCTGTGAGGATAACTCGAGTTATCCTCACAGAATATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008378.2-2463s1c1
Sequence:CCGGGAGTTATAGGATGACCTATATCTCGAGATATAGGTCATCCTATAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-977s1c1
Sequence:CCGGGACGAGTCAACTAAGAATTTGCTCGAGCAAATTCTTAGTTGACTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008378.2-1527s1c1
Sequence:CCGGCACGCTTCCTTCCATAGTATTCTCGAGAATACTATGGAAGGAAGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008378
VALIDATED
IMPACT MISSION shRNA shRNA Plasmid DNA
impact RWD domain protein
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008378.1-491s1c1
Sequence:CCGGGAGTCCGAAGAAGACCCTATTCTCGAGAATAGGGTCTTCTTCGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008378.1-2214s1c1
Sequence:CCGGGCCAACAATGACTAAATTGATCTCGAGATCAATTTAGTCATTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008378.1-121s1c1
Sequence:CCGGGAGTGAAGAAATCGAAGCAATCTCGAGATTGCTTCGATTTCTTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008378.1-925s1c1
Sequence:CCGGCAACAACTGTGCCAGGAACATCTCGAGATGTTCCTGGCACAGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.1-373s1c1
Sequence:CCGGCATGGGTGAATCTATTCTTTACTCGAGTAAAGAATAGATTCACCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-690s21c1
Sequence:CCGGTTGCCAAGCTGTACGAGAATACTCGAGTATTCTCGTACAGCTTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-749s21c1
Sequence:CCGGAGGATATTCTGTGAGGATAAACTCGAGTTTATCCTCACAGAATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-971s21c1
Sequence:CCGGACTCCTGACGAGTCAACTAAGCTCGAGCTTAGTTGACTCGTCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-2203s21c1
Sequence:CCGGGCCAACAATGACTAAATTGATCTCGAGATCAATTTAGTCATTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-491s21c1
Sequence:CCGGGAGTCCGAAGAAGACCCTATTCTCGAGAATAGGGTCTTCTTCGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-227s1c1
Sequence:CCGGCCCAAATGGACACTTTGTTTACTCGAGTAAACAAAGTGTCCATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-748s1c1
Sequence:CCGGCAGGATATTCTGTGAGGATAACTCGAGTTATCCTCACAGAATATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008378.2-2463s1c1
Sequence:CCGGGAGTTATAGGATGACCTATATCTCGAGATATAGGTCATCCTATAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-977s1c1
Sequence:CCGGGACGAGTCAACTAAGAATTTGCTCGAGCAAATTCTTAGTTGACTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008378.2-1527s1c1
Sequence:CCGGCACGCTTCCTTCCATAGTATTCTCGAGAATACTATGGAAGGAAGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008378
VALIDATED
IMPACT MISSION shRNA Lentiviral Transduction Particles
impact RWD domain protein
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008378.1-491s1c1
Sequence:CCGGGAGTCCGAAGAAGACCCTATTCTCGAGAATAGGGTCTTCTTCGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008378.1-2214s1c1
Sequence:CCGGGCCAACAATGACTAAATTGATCTCGAGATCAATTTAGTCATTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008378.1-121s1c1
Sequence:CCGGGAGTGAAGAAATCGAAGCAATCTCGAGATTGCTTCGATTTCTTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008378.1-925s1c1
Sequence:CCGGCAACAACTGTGCCAGGAACATCTCGAGATGTTCCTGGCACAGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.1-373s1c1
Sequence:CCGGCATGGGTGAATCTATTCTTTACTCGAGTAAAGAATAGATTCACCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-690s21c1
Sequence:CCGGTTGCCAAGCTGTACGAGAATACTCGAGTATTCTCGTACAGCTTGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-749s21c1
Sequence:CCGGAGGATATTCTGTGAGGATAAACTCGAGTTTATCCTCACAGAATATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-971s21c1
Sequence:CCGGACTCCTGACGAGTCAACTAAGCTCGAGCTTAGTTGACTCGTCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-2203s21c1
Sequence:CCGGGCCAACAATGACTAAATTGATCTCGAGATCAATTTAGTCATTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008378.2-491s21c1
Sequence:CCGGGAGTCCGAAGAAGACCCTATTCTCGAGAATAGGGTCTTCTTCGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-227s1c1
Sequence:CCGGCCCAAATGGACACTTTGTTTACTCGAGTAAACAAAGTGTCCATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-748s1c1
Sequence:CCGGCAGGATATTCTGTGAGGATAACTCGAGTTATCCTCACAGAATATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008378.2-2463s1c1
Sequence:CCGGGAGTTATAGGATGACCTATATCTCGAGATATAGGTCATCCTATAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008378.2-977s1c1
Sequence:CCGGGACGAGTCAACTAAGAATTTGCTCGAGCAAATTCTTAGTTGACTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008378.2-1527s1c1
Sequence:CCGGCACGCTTCCTTCCATAGTATTCTCGAGAATACTATGGAAGGAAGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018439
VALIDATED
IMPACT MISSION shRNA Bacterial Glycerol Stock
impact RWD domain protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-212s1c1
Sequence:CCGGTGCCGAATGAATACCCAGGTACTCGAGTACCTGGGTATTCATTCGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-433s1c1
Sequence:CCGGGAGGAAGATGTTGAATGTGAACTCGAGTTCACATTCAACATCTTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-238s1c1
Sequence:CCGGCCACCTATCTACCAGTTGAATCTCGAGATTCAACTGGTAGATAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018439.x-2051s1c1
Sequence:CCGGCCCTCTATTCATCAAACCTTTCTCGAGAAAGGTTTGATGAATAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018439.x-854s1c1
Sequence:CCGGTGCTAGGACCAGATCGCTTTACTCGAGTAAAGCGATCTGGTCCTAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018439.3-1502s21c1
Sequence:CCGGATTGGAATAGGAGCTCATTTACTCGAGTAAATGAGCTCCTATTCCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-1001s21c1
Sequence:CCGGTCACCTGAGGAGTCATCTAAGCTCGAGCTTAGATGACTCCTCAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-472s21c1
Sequence:CCGGAGAACCAGGCCCAGATGTAAACTCGAGTTTACATCTGGGCCTGGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-395s21c1
Sequence:CCGGCAGAATATCGGTGAAAGTATTCTCGAGAATACTTTCACCGATATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018439.3-1126s21c1
Sequence:CCGGCATAGTCATCAAGGAATATATCTCGAGATATATTCCTTGATGACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-886s21c1
Sequence:CCGGGAATGTCATGGTGGTAGTATCCTCGAGGATACTACCACCATGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018439
VALIDATED
IMPACT MISSION shRNA shRNA Plasmid DNA
impact RWD domain protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-212s1c1
Sequence:CCGGTGCCGAATGAATACCCAGGTACTCGAGTACCTGGGTATTCATTCGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-433s1c1
Sequence:CCGGGAGGAAGATGTTGAATGTGAACTCGAGTTCACATTCAACATCTTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-238s1c1
Sequence:CCGGCCACCTATCTACCAGTTGAATCTCGAGATTCAACTGGTAGATAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018439.x-2051s1c1
Sequence:CCGGCCCTCTATTCATCAAACCTTTCTCGAGAAAGGTTTGATGAATAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018439.x-854s1c1
Sequence:CCGGTGCTAGGACCAGATCGCTTTACTCGAGTAAAGCGATCTGGTCCTAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018439.3-1502s21c1
Sequence:CCGGATTGGAATAGGAGCTCATTTACTCGAGTAAATGAGCTCCTATTCCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-1001s21c1
Sequence:CCGGTCACCTGAGGAGTCATCTAAGCTCGAGCTTAGATGACTCCTCAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-472s21c1
Sequence:CCGGAGAACCAGGCCCAGATGTAAACTCGAGTTTACATCTGGGCCTGGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-395s21c1
Sequence:CCGGCAGAATATCGGTGAAAGTATTCTCGAGAATACTTTCACCGATATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018439.3-1126s21c1
Sequence:CCGGCATAGTCATCAAGGAATATATCTCGAGATATATTCCTTGATGACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-886s21c1
Sequence:CCGGGAATGTCATGGTGGTAGTATCCTCGAGGATACTACCACCATGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018439
VALIDATED
IMPACT MISSION shRNA Lentiviral Transduction Particles
impact RWD domain protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-212s1c1
Sequence:CCGGTGCCGAATGAATACCCAGGTACTCGAGTACCTGGGTATTCATTCGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-433s1c1
Sequence:CCGGGAGGAAGATGTTGAATGTGAACTCGAGTTCACATTCAACATCTTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018439.x-238s1c1
Sequence:CCGGCCACCTATCTACCAGTTGAATCTCGAGATTCAACTGGTAGATAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018439.x-2051s1c1
Sequence:CCGGCCCTCTATTCATCAAACCTTTCTCGAGAAAGGTTTGATGAATAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018439.x-854s1c1
Sequence:CCGGTGCTAGGACCAGATCGCTTTACTCGAGTAAAGCGATCTGGTCCTAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018439.3-1502s21c1
Sequence:CCGGATTGGAATAGGAGCTCATTTACTCGAGTAAATGAGCTCCTATTCCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-1001s21c1
Sequence:CCGGTCACCTGAGGAGTCATCTAAGCTCGAGCTTAGATGACTCCTCAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-472s21c1
Sequence:CCGGAGAACCAGGCCCAGATGTAAACTCGAGTTTACATCTGGGCCTGGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-395s21c1
Sequence:CCGGCAGAATATCGGTGAAAGTATTCTCGAGAATACTTTCACCGATATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018439.3-1126s21c1
Sequence:CCGGCATAGTCATCAAGGAATATATCTCGAGATATATTCCTTGATGACTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018439.3-886s21c1
Sequence:CCGGGAATGTCATGGTGGTAGTATCCTCGAGGATACTACCACCATGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)