EMAIL THIS PAGE TO A FRIEND

IMPDH1

IMP (inosine 5'-monophosphate) dehydrogenase 1

76 Gene Product Result for
Synonyms: IMPD IMPD1 LCA11 RP10 sWSS2608
Gene ID:
Human(3614) Summary: The protein encoded by this gene acts as a homotetramer to regulate cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). This is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in this gene are a cause of retinitis pigmentosa type 10 (RP10). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(23917) inosine 5'-phosphate dehydrogenase 1
Rat(362329) IMP (inosine 5'-monophosphate) dehydrogenase 1
sheep(101104144) IMP (inosine 5'-monophosphate) dehydrogenase 1
Domestic Rabbit(100357217) IMP (inosine 5'-monophosphate) dehydrogenase 1
domestic guinea pig(100717020) IMP (inosine 5'-monophosphate) dehydrogenase 1
naked mole-rat(101720344) IMP (inosine 5'-monophosphate) dehydrogenase 1
cow(504305) IMP (inosine 5'-monophosphate) dehydrogenase 1
domestic cat(101084274) IMP (inosine 5'-monophosphate) dehydrogenase 1
Horse(100071737) IMP (inosine 5'-monophosphate) dehydrogenase 1
dog(608783) IMP (inosine 5'-monophosphate) dehydrogenase 1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_183243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183243 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000883 Rosetta Predictions human pricing
NM_001102605 Rosetta Predictions human pricing
NM_183243 Rosetta Predictions human pricing
NM_001108619 Rosetta Predictions rat pricing
NM_011829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188051 predicted 909
2 SASI_Hs01_00188052 predicted 1525
3 SASI_Hs01_00188055 predicted 559
4 SASI_Hs01_00188056 predicted 1379
5 SASI_Hs01_00188057 predicted 950
6 SASI_Hs01_00188058 predicted 1826
7 SASI_Hs02_00303425 predicted 948
8 SASI_Hs02_00303426 predicted 1160
9 SASI_Hs01_00188059 predicted 1167
10 SASI_Hs01_00188060 predicted 1466
11 SASI_Hs01_00188053 predicted 1946
12 SASI_Hs01_00188054 predicted 2063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323379 predicted 877
2 SASI_Hs02_00323380 predicted 1491
3 SASI_Hs02_00323381 predicted 523
4 SASI_Hs02_00323382 predicted 1357
5 SASI_Hs02_00323383 predicted 917
6 SASI_Hs02_00323384 predicted 1792
7 SASI_Hs02_00323385 predicted 923
8 SASI_Hs02_00323386 predicted 1132
9 SASI_Hs02_00323387 predicted 1135
10 SASI_Hs02_00323388 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241618 predicted 797
2 SASI_Hs01_00241619 predicted 1414
3 SASI_Hs01_00241622 predicted 453
4 SASI_Hs01_00241623 predicted 1273
5 SASI_Hs01_00241624 predicted 846
6 SASI_Hs01_00241625 predicted 1719
7 SASI_Hs02_00371254 predicted 843
8 SASI_Hs02_00371255 predicted 1057
9 SASI_Hs01_00241626 predicted 1065
10 SASI_Hs01_00241627 predicted 1358
11 SASI_Hs01_00241620 predicted 1575
12 SASI_Hs01_00241621 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240419 predicted 1285
2 SASI_Rn02_00240420 predicted 837
3 SASI_Rn02_00240421 predicted 1325
4 SASI_Rn02_00240422 predicted 499
5 SASI_Rn02_00240423 predicted 1063
6 SASI_Rn02_00240424 predicted 627
7 SASI_Rn02_00240425 predicted 426
8 SASI_Rn02_00240426 predicted 714
9 SASI_Rn02_00240427 predicted 1477
10 SASI_Rn02_00240428 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026907 predicted 329
2 SASI_Mm01_00026908 predicted 743
3 SASI_Mm01_00026909 predicted 1441
4 SASI_Mm01_00026910 predicted 292
5 SASI_Mm01_00026911 predicted 1468
6 SASI_Mm01_00026912 predicted 1028
7 SASI_Mm01_00026913 predicted 330
8 SASI_Mm01_00026914 predicted 676
9 SASI_Mm01_00026915 predicted 361
10 SASI_Mm01_00026916 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011829
VALIDATED
IMPDH1 MISSION shRNA Bacterial Glycerol Stock
IMP (inosine 5'-monophosphate) dehydrogenase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-1718s1c1
Sequence:CCGGCTCCAGAACTAAGTGGTCCATCTCGAGATGGACCACTTAGTTCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-1408s1c1
Sequence:CCGGGATAAGGTGAAGATCGCACAACTCGAGTTGTGCGATCTTCACCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-472s1c1
Sequence:CCGGCCTTCACATACTGTGGGTGATCTCGAGATCACCCACAGTATGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011829.2-1718s21c1
Sequence:CCGGCTCCAGAACTAAGTGGTCCATCTCGAGATGGACCACTTAGTTCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-472s21c1
Sequence:CCGGCCTTCACATACTGTGGGTGATCTCGAGATCACCCACAGTATGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-1408s21c1
Sequence:CCGGGATAAGGTGAAGATCGCACAACTCGAGTTGTGCGATCTTCACCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-954s21c1
Sequence:CCGGGATCGCCATGGTGCACTATATCTCGAGATATAGTGCACCATGGCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-212s21c1
Sequence:CCGGTGATCCTCCCAGGATTCATAGCTCGAGCTATGAATCCTGGGAGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011829
VALIDATED
IMPDH1 MISSION shRNA shRNA Plasmid DNA
IMP (inosine 5'-monophosphate) dehydrogenase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-1718s1c1
Sequence:CCGGCTCCAGAACTAAGTGGTCCATCTCGAGATGGACCACTTAGTTCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-1408s1c1
Sequence:CCGGGATAAGGTGAAGATCGCACAACTCGAGTTGTGCGATCTTCACCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-472s1c1
Sequence:CCGGCCTTCACATACTGTGGGTGATCTCGAGATCACCCACAGTATGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011829.2-1718s21c1
Sequence:CCGGCTCCAGAACTAAGTGGTCCATCTCGAGATGGACCACTTAGTTCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-472s21c1
Sequence:CCGGCCTTCACATACTGTGGGTGATCTCGAGATCACCCACAGTATGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-1408s21c1
Sequence:CCGGGATAAGGTGAAGATCGCACAACTCGAGTTGTGCGATCTTCACCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-954s21c1
Sequence:CCGGGATCGCCATGGTGCACTATATCTCGAGATATAGTGCACCATGGCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-212s21c1
Sequence:CCGGTGATCCTCCCAGGATTCATAGCTCGAGCTATGAATCCTGGGAGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011829
VALIDATED
IMPDH1 MISSION shRNA Lentiviral Transduction Particles
IMP (inosine 5'-monophosphate) dehydrogenase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-1718s1c1
Sequence:CCGGCTCCAGAACTAAGTGGTCCATCTCGAGATGGACCACTTAGTTCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-1408s1c1
Sequence:CCGGGATAAGGTGAAGATCGCACAACTCGAGTTGTGCGATCTTCACCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011829.2-472s1c1
Sequence:CCGGCCTTCACATACTGTGGGTGATCTCGAGATCACCCACAGTATGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011829.2-1718s21c1
Sequence:CCGGCTCCAGAACTAAGTGGTCCATCTCGAGATGGACCACTTAGTTCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-472s21c1
Sequence:CCGGCCTTCACATACTGTGGGTGATCTCGAGATCACCCACAGTATGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-1408s21c1
Sequence:CCGGGATAAGGTGAAGATCGCACAACTCGAGTTGTGCGATCTTCACCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-954s21c1
Sequence:CCGGGATCGCCATGGTGCACTATATCTCGAGATATAGTGCACCATGGCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011829.2-212s21c1
Sequence:CCGGTGATCCTCCCAGGATTCATAGCTCGAGCTATGAATCCTGGGAGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183243
IMPDH1 MISSION shRNA Bacterial Glycerol Stock
IMP (inosine 5'-monophosphate) dehydrogenase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-911s1c1
Sequence:CCGGCCTGAAGAAGAACCGAGACTACTCGAGTAGTCTCGGTTCTTCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-546s1c1
Sequence:CCGGCGGAAGGTCAAGAAGTTTGAACTCGAGTTCAAACTTCTTGACCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-1589s1c1
Sequence:CCGGCATTCAGAAGTTCGTGCCCTACTCGAGTAGGGCACGAACTTCTGAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-348s1c1
Sequence:CCGGCCAGGATTCATAGACTTCATACTCGAGTATGAAGTCTATGAATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-807s1c1
Sequence:CCGGGTGACGTTGAAAGAGGCAAATCTCGAGATTTGCCTCTTTCAACGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-703s21c1
Sequence:CCGGACCTCCCGAGACATCGACTTTCTCGAGAAAGTCGATGTCTCGGGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-982s21c1
Sequence:CCGGACCCGTGAGGATGACAAATACCTCGAGGTATTTGTCATCCTCACGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-848s21c1
Sequence:CCGGGGAAGCTGCCTATCGTCAATGCTCGAGCATTGACGATAGGCAGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183243
IMPDH1 MISSION shRNA shRNA Plasmid DNA
IMP (inosine 5'-monophosphate) dehydrogenase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-911s1c1
Sequence:CCGGCCTGAAGAAGAACCGAGACTACTCGAGTAGTCTCGGTTCTTCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-546s1c1
Sequence:CCGGCGGAAGGTCAAGAAGTTTGAACTCGAGTTCAAACTTCTTGACCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-1589s1c1
Sequence:CCGGCATTCAGAAGTTCGTGCCCTACTCGAGTAGGGCACGAACTTCTGAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-348s1c1
Sequence:CCGGCCAGGATTCATAGACTTCATACTCGAGTATGAAGTCTATGAATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-807s1c1
Sequence:CCGGGTGACGTTGAAAGAGGCAAATCTCGAGATTTGCCTCTTTCAACGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-703s21c1
Sequence:CCGGACCTCCCGAGACATCGACTTTCTCGAGAAAGTCGATGTCTCGGGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-982s21c1
Sequence:CCGGACCCGTGAGGATGACAAATACCTCGAGGTATTTGTCATCCTCACGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-848s21c1
Sequence:CCGGGGAAGCTGCCTATCGTCAATGCTCGAGCATTGACGATAGGCAGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183243
IMPDH1 MISSION shRNA Lentiviral Transduction Particles
IMP (inosine 5'-monophosphate) dehydrogenase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-911s1c1
Sequence:CCGGCCTGAAGAAGAACCGAGACTACTCGAGTAGTCTCGGTTCTTCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-546s1c1
Sequence:CCGGCGGAAGGTCAAGAAGTTTGAACTCGAGTTCAAACTTCTTGACCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-1589s1c1
Sequence:CCGGCATTCAGAAGTTCGTGCCCTACTCGAGTAGGGCACGAACTTCTGAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-348s1c1
Sequence:CCGGCCAGGATTCATAGACTTCATACTCGAGTATGAAGTCTATGAATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183243.1-807s1c1
Sequence:CCGGGTGACGTTGAAAGAGGCAAATCTCGAGATTTGCCTCTTTCAACGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-703s21c1
Sequence:CCGGACCTCCCGAGACATCGACTTTCTCGAGAAAGTCGATGTCTCGGGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-982s21c1
Sequence:CCGGACCCGTGAGGATGACAAATACCTCGAGGTATTTGTCATCCTCACGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183243.2-848s21c1
Sequence:CCGGGGAAGCTGCCTATCGTCAATGCTCGAGCATTGACGATAGGCAGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)