EMAIL THIS PAGE TO A FRIEND

IMPDH2

IMP (inosine 5'-monophosphate) dehydrogenase 2

70 Gene Product Result for
Synonyms: IMPD2 IMPDH-II
UniProtKB ID: P12268, Q6LEF3
Gene ID:
Human(3615) Summary: This gene encodes the rate-limiting enzyme in the de novo guanine nucleotide biosynthesis. It is thus involved in maintaining cellular guanine deoxy- and ribonucleotide pools needed for DNA and RNA synthesis. The encoded protein catalyzes the NAD-dependent oxidation of inosine-5'-monophosphate into xanthine-5'-monophosphate, which is then converted into guanosine-5'-monophosphate. This gene is up-regulated in some neoplasms, suggesting it may play a role in malignant transformation. [provided by RefSeq, Jul 2008]
Mouse(23918) inosine 5'-phosphate dehydrogenase 2
Rat(301005) IMP (inosine 5'-monophosphate) dehydrogenase 2
Zebrafish(317745) IMP (inosine monophosphate) dehydrogenase 2
Horse(100063255) IMP (inosine 5'-monophosphate) dehydrogenase 2
cow(511969) IMP (inosine 5'-monophosphate) dehydrogenase 2
domestic cat(101080693) IMP (inosine 5'-monophosphate) dehydrogenase 2
chicken(416058) IMP (inosine 5'-monophosphate) dehydrogenase 2
dog(476630) IMP (inosine 5'-monophosphate) dehydrogenase 2
domestic guinea pig(100730768) IMP (inosine 5'-monophosphate) dehydrogenase 2
naked mole-rat(101701391) IMP (inosine 5'-monophosphate) dehydrogenase 2
sheep(101107823) IMP (inosine 5'-monophosphate) dehydrogenase 2
Domestic Rabbit(100355621) IMP (inosine 5'-monophosphate) dehydrogenase 2
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000884 Rosetta Predictions human pricing
NM_199099 Rosetta Predictions rat pricing
NM_011830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303427 predicted 1163
2 SASI_Hs01_00224364 predicted 385
3 SASI_Hs01_00224367 predicted 838
4 SASI_Hs01_00224368 predicted 1431
5 SASI_Hs01_00224369 predicted 1125
6 SASI_Hs01_00224370 predicted 237
7 SASI_Hs02_00303428 predicted 1125
8 SASI_Hs01_00224371 predicted 453
9 SASI_Hs01_00224372 predicted 1310
10 SASI_Hs02_00303429 predicted 1237
11 SASI_Hs01_00224363 predicted 922
12 SASI_Hs01_00224365 predicted 716
13 SASI_Hs01_00224366 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039052 predicted 579
2 SASI_Rn01_00039053 predicted 676
3 SASI_Rn01_00039055 predicted 1081
4 SASI_Rn01_00039056 predicted 418
5 SASI_Rn01_00039057 predicted 1244
6 SASI_Rn01_00039058 predicted 503
7 SASI_Rn01_00039059 predicted 217
8 SASI_Rn01_00039060 predicted 646
9 SASI_Rn01_00039061 predicted 1326
10 SASI_Rn02_00270117 predicted 825
11 SASI_Rn01_00039054 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167832 predicted 292
2 SASI_Mm01_00167833 predicted 327
3 SASI_Mm02_00321545 predicted 645
4 SASI_Mm01_00167834 predicted 964
5 SASI_Mm01_00167835 predicted 401
6 SASI_Mm01_00167836 predicted 625
7 SASI_Mm02_00321546 predicted 1079
8 SASI_Mm01_00167837 predicted 487
9 SASI_Mm01_00167839 predicted 923
10 SASI_Mm01_00167840 predicted 272
11 SASI_Mm01_00167831 predicted 617
12 SASI_Mm01_00167838 predicted 1077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000884
VALIDATED
IMPDH2 MISSION shRNA Bacterial Glycerol Stock
IMP (inosine 5'-monophosphate) dehydrogenase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-1439s21c1
Sequence:CCGGCAAAGGGTCAATCCACAAATTCTCGAGAATTTGTGGATTGACCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000884.2-405s21c1
Sequence:CCGGCGGAAAGTGAAGAAATATGAACTCGAGTTCATATTTCTTCACTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-182s21c1
Sequence:CCGGCACCTACAATGACTTTCTCATCTCGAGATGAGAAAGTCATTGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-360s1c1
Sequence:CCGGCGGAAAGTGAAGAAATATGAACTCGAGTTCATATTTCTTCACTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-137s1c1
Sequence:CCGGCACCTACAATGACTTTCTCATCTCGAGATGAGAAAGTCATTGTAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000884.1-1268s1c1
Sequence:CCGGGCTAAAGAAATATCGCGGTATCTCGAGATACCGCGATATTTCTTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-561s1c1
Sequence:CCGGGACTGTTTCTTGGAAGAGATACTCGAGTATCTCTTCCAAGAAACAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-606s21c1
Sequence:CCGGGACTGTTTCTTGGAAGAGATACTCGAGTATCTCTTCCAAGAAACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-1394s1c1
Sequence:CCGGCAAAGGGTCAATCCACAAATTCTCGAGAATTTGTGGATTGACCCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000884
VALIDATED
IMPDH2 MISSION shRNA shRNA Plasmid DNA
IMP (inosine 5'-monophosphate) dehydrogenase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-1439s21c1
Sequence:CCGGCAAAGGGTCAATCCACAAATTCTCGAGAATTTGTGGATTGACCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000884.2-405s21c1
Sequence:CCGGCGGAAAGTGAAGAAATATGAACTCGAGTTCATATTTCTTCACTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-182s21c1
Sequence:CCGGCACCTACAATGACTTTCTCATCTCGAGATGAGAAAGTCATTGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-360s1c1
Sequence:CCGGCGGAAAGTGAAGAAATATGAACTCGAGTTCATATTTCTTCACTTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-137s1c1
Sequence:CCGGCACCTACAATGACTTTCTCATCTCGAGATGAGAAAGTCATTGTAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000884.1-1268s1c1
Sequence:CCGGGCTAAAGAAATATCGCGGTATCTCGAGATACCGCGATATTTCTTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-561s1c1
Sequence:CCGGGACTGTTTCTTGGAAGAGATACTCGAGTATCTCTTCCAAGAAACAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-606s21c1
Sequence:CCGGGACTGTTTCTTGGAAGAGATACTCGAGTATCTCTTCCAAGAAACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-1394s1c1
Sequence:CCGGCAAAGGGTCAATCCACAAATTCTCGAGAATTTGTGGATTGACCCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000884
VALIDATED
IMPDH2 MISSION shRNA Lentiviral Transduction Particles
IMP (inosine 5'-monophosphate) dehydrogenase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-1439s21c1
Sequence:CCGGCAAAGGGTCAATCCACAAATTCTCGAGAATTTGTGGATTGACCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000884.2-405s21c1
Sequence:CCGGCGGAAAGTGAAGAAATATGAACTCGAGTTCATATTTCTTCACTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-182s21c1
Sequence:CCGGCACCTACAATGACTTTCTCATCTCGAGATGAGAAAGTCATTGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-360s1c1
Sequence:CCGGCGGAAAGTGAAGAAATATGAACTCGAGTTCATATTTCTTCACTTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-137s1c1
Sequence:CCGGCACCTACAATGACTTTCTCATCTCGAGATGAGAAAGTCATTGTAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000884.1-1268s1c1
Sequence:CCGGGCTAAAGAAATATCGCGGTATCTCGAGATACCGCGATATTTCTTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-561s1c1
Sequence:CCGGGACTGTTTCTTGGAAGAGATACTCGAGTATCTCTTCCAAGAAACAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000884.2-606s21c1
Sequence:CCGGGACTGTTTCTTGGAAGAGATACTCGAGTATCTCTTCCAAGAAACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000884.1-1394s1c1
Sequence:CCGGCAAAGGGTCAATCCACAAATTCTCGAGAATTTGTGGATTGACCCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011830
VALIDATED
IMPDH2 MISSION shRNA Bacterial Glycerol Stock
IMP (inosine 5'-monophosphate) dehydrogenase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-1254s1c1
Sequence:CCGGGCTGAAGAAATACCGAGGTATCTCGAGATACCTCGGTATTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-567s1c1
Sequence:CCGGCATGACTAAGAGGGAAGATTTCTCGAGAAATCTTCCCTCTTAGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-1069s1c1
Sequence:CCGGGCAGTGTACAAGGTCTCTGAACTCGAGTTCAGAGACCTTGTACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-799s1c1
Sequence:CCGGGACAAGTATAGGCTGGACTTACTCGAGTAAGTCCAGCCTATACTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-711s1c1
Sequence:CCGGCCTAAAGAAGAATCGTGATTACTCGAGTAATCACGATTCTTCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011830
VALIDATED
IMPDH2 MISSION shRNA shRNA Plasmid DNA
IMP (inosine 5'-monophosphate) dehydrogenase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-1254s1c1
Sequence:CCGGGCTGAAGAAATACCGAGGTATCTCGAGATACCTCGGTATTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-567s1c1
Sequence:CCGGCATGACTAAGAGGGAAGATTTCTCGAGAAATCTTCCCTCTTAGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-1069s1c1
Sequence:CCGGGCAGTGTACAAGGTCTCTGAACTCGAGTTCAGAGACCTTGTACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-799s1c1
Sequence:CCGGGACAAGTATAGGCTGGACTTACTCGAGTAAGTCCAGCCTATACTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-711s1c1
Sequence:CCGGCCTAAAGAAGAATCGTGATTACTCGAGTAATCACGATTCTTCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011830
VALIDATED
IMPDH2 MISSION shRNA Lentiviral Transduction Particles
IMP (inosine 5'-monophosphate) dehydrogenase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-1254s1c1
Sequence:CCGGGCTGAAGAAATACCGAGGTATCTCGAGATACCTCGGTATTTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-567s1c1
Sequence:CCGGCATGACTAAGAGGGAAGATTTCTCGAGAAATCTTCCCTCTTAGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-1069s1c1
Sequence:CCGGGCAGTGTACAAGGTCTCTGAACTCGAGTTCAGAGACCTTGTACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-799s1c1
Sequence:CCGGGACAAGTATAGGCTGGACTTACTCGAGTAAGTCCAGCCTATACTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011830.2-711s1c1
Sequence:CCGGCCTAAAGAAGAATCGTGATTACTCGAGTAATCACGATTCTTCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)