EMAIL THIS PAGE TO A FRIEND

IMPG1

interphotoreceptor matrix proteoglycan 1

67 Gene Product Result for
Synonyms: GP147 IPM150 SPACR
UniProtKB ID: Q17R60, A6NNZ6, O43686, O95094, Q9BWZ1
Gene ID:
Mouse(63859) interphotoreceptor matrix proteoglycan 1
Rat(66014) interphotoreceptor matrix proteoglycan 1
chicken(374088) interphotoreceptor matrix proteoglycan 1
cow(281866) interphotoreceptor matrix proteoglycan 1
domestic cat(101095015) interphotoreceptor matrix proteoglycan 1
dog(481885) interphotoreceptor matrix proteoglycan 1
sheep(101119315) interphotoreceptor matrix proteoglycan 1
domestic guinea pig(100715935) interphotoreceptor matrix proteoglycan 1
naked mole-rat(101720746) interphotoreceptor matrix proteoglycan 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018661 MISSION® esiRNA esiRNA targeting human IMPG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001563 Rosetta Predictions human pricing
NM_023958 Rosetta Predictions rat pricing
NM_022016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067784 predicted 1731
2 SASI_Hs01_00067785 predicted 2207
3 SASI_Hs02_00332131 predicted 600
4 SASI_Hs01_00067786 predicted 1517
5 SASI_Hs01_00067787 predicted 461
6 SASI_Hs01_00067788 predicted 2463
7 SASI_Hs01_00067789 predicted 1029
8 SASI_Hs01_00067790 predicted 2158
9 SASI_Hs01_00067791 predicted 2049
10 SASI_Hs01_00067793 predicted 1797
11 SASI_Hs01_00067792 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118415 predicted 642
2 SASI_Rn01_00118416 predicted 2519
3 SASI_Rn01_00118417 predicted 671
4 SASI_Rn02_00263765 predicted 259
5 SASI_Rn01_00118418 predicted 441
6 SASI_Rn01_00118419 predicted 2144
7 SASI_Rn01_00118420 predicted 1351
8 SASI_Rn01_00118421 predicted 450
9 SASI_Rn01_00118422 predicted 372
10 SASI_Rn02_00263766 predicted 1249
11 SASI_Rn01_00118414 predicted 1049
12 SASI_Rn01_00118423 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042642 predicted 2553
2 SASI_Mm01_00042643 predicted 2544
3 SASI_Mm01_00042644 predicted 1001
4 SASI_Mm01_00042645 predicted 2234
5 SASI_Mm02_00326489 predicted 203
6 SASI_Mm02_00326490 predicted 2606
7 SASI_Mm01_00042646 predicted 471
8 SASI_Mm01_00042648 predicted 1228
9 SASI_Mm01_00042649 predicted 446
10 SASI_Mm01_00042650 predicted 2159
11 SASI_Mm01_00042647 predicted 1277
12 SASI_Mm01_00042651 predicted 1865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001563
IMPG1 MISSION shRNA Bacterial Glycerol Stock
interphotoreceptor matrix proteoglycan 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-745s1c1
Sequence:CCGGCCTCAATGAAATTCTCGATAACTCGAGTTATCGAGAATTTCATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-2219s1c1
Sequence:CCGGGCCCAATGTGTAAAGAACGAACTCGAGTTCGTTCTTTACACATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-1970s1c1
Sequence:CCGGCGATCCAATCTTACAGGATTTCTCGAGAAATCCTGTAAGATTGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-2500s1c1
Sequence:CCGGCCATCAAGATTGGGAAGGAAACTCGAGTTTCCTTCCCAATCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001563.2-2053s21c1
Sequence:CCGGTGCTAAGTCTGTGCCGTATAACTCGAGTTATACGGCACAGACTTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001563.2-292s21c1
Sequence:CCGGGTCAACTATGAGACGAATATTCTCGAGAATATTCGTCTCATAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001563.2-2744s21c1
Sequence:CCGGTGCAATCAGCGAAACATATTTCTCGAGAAATATGTTTCGCTGATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001563
IMPG1 MISSION shRNA shRNA Plasmid DNA
interphotoreceptor matrix proteoglycan 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-745s1c1
Sequence:CCGGCCTCAATGAAATTCTCGATAACTCGAGTTATCGAGAATTTCATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-2219s1c1
Sequence:CCGGGCCCAATGTGTAAAGAACGAACTCGAGTTCGTTCTTTACACATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-1970s1c1
Sequence:CCGGCGATCCAATCTTACAGGATTTCTCGAGAAATCCTGTAAGATTGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-2500s1c1
Sequence:CCGGCCATCAAGATTGGGAAGGAAACTCGAGTTTCCTTCCCAATCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001563.2-2053s21c1
Sequence:CCGGTGCTAAGTCTGTGCCGTATAACTCGAGTTATACGGCACAGACTTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001563.2-292s21c1
Sequence:CCGGGTCAACTATGAGACGAATATTCTCGAGAATATTCGTCTCATAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001563.2-2744s21c1
Sequence:CCGGTGCAATCAGCGAAACATATTTCTCGAGAAATATGTTTCGCTGATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001563
IMPG1 MISSION shRNA Lentiviral Transduction Particles
interphotoreceptor matrix proteoglycan 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-745s1c1
Sequence:CCGGCCTCAATGAAATTCTCGATAACTCGAGTTATCGAGAATTTCATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-2219s1c1
Sequence:CCGGGCCCAATGTGTAAAGAACGAACTCGAGTTCGTTCTTTACACATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-1970s1c1
Sequence:CCGGCGATCCAATCTTACAGGATTTCTCGAGAAATCCTGTAAGATTGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001563.2-2500s1c1
Sequence:CCGGCCATCAAGATTGGGAAGGAAACTCGAGTTTCCTTCCCAATCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001563.2-2053s21c1
Sequence:CCGGTGCTAAGTCTGTGCCGTATAACTCGAGTTATACGGCACAGACTTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001563.2-292s21c1
Sequence:CCGGGTCAACTATGAGACGAATATTCTCGAGAATATTCGTCTCATAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001563.2-2744s21c1
Sequence:CCGGTGCAATCAGCGAAACATATTTCTCGAGAAATATGTTTCGCTGATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022016
IMPG1 MISSION shRNA Bacterial Glycerol Stock
interphotoreceptor matrix proteoglycan 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022016.1-2633s1c1
Sequence:CCGGCGTGTATTTGATGACAGTTAACTCGAGTTAACTGTCATCAAATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-1925s1c1
Sequence:CCGGCGGGATTTAAGCAACTGGAAACTCGAGTTTCCAGTTGCTTAAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-1913s1c1
Sequence:CCGGGATCGAATCTTACGGGATTTACTCGAGTAAATCCCGTAAGATTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-2313s1c1
Sequence:CCGGGCCACCAGATCACTCTACAAACTCGAGTTTGTAGAGTGATCTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-388s1c1
Sequence:CCGGCGTATCTTTCTGGACCGAATTCTCGAGAATTCGGTCCAGAAAGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022016
IMPG1 MISSION shRNA shRNA Plasmid DNA
interphotoreceptor matrix proteoglycan 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022016.1-2633s1c1
Sequence:CCGGCGTGTATTTGATGACAGTTAACTCGAGTTAACTGTCATCAAATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-1925s1c1
Sequence:CCGGCGGGATTTAAGCAACTGGAAACTCGAGTTTCCAGTTGCTTAAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-1913s1c1
Sequence:CCGGGATCGAATCTTACGGGATTTACTCGAGTAAATCCCGTAAGATTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-2313s1c1
Sequence:CCGGGCCACCAGATCACTCTACAAACTCGAGTTTGTAGAGTGATCTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-388s1c1
Sequence:CCGGCGTATCTTTCTGGACCGAATTCTCGAGAATTCGGTCCAGAAAGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022016
IMPG1 MISSION shRNA Lentiviral Transduction Particles
interphotoreceptor matrix proteoglycan 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022016.1-2633s1c1
Sequence:CCGGCGTGTATTTGATGACAGTTAACTCGAGTTAACTGTCATCAAATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-1925s1c1
Sequence:CCGGCGGGATTTAAGCAACTGGAAACTCGAGTTTCCAGTTGCTTAAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-1913s1c1
Sequence:CCGGGATCGAATCTTACGGGATTTACTCGAGTAAATCCCGTAAGATTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-2313s1c1
Sequence:CCGGGCCACCAGATCACTCTACAAACTCGAGTTTGTAGAGTGATCTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022016.1-388s1c1
Sequence:CCGGCGTATCTTTCTGGACCGAATTCTCGAGAATTCGGTCCAGAAAGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)