EMAIL THIS PAGE TO A FRIEND

IMPG2

interphotoreceptor matrix proteoglycan 2

76 Gene Product Result for
Synonyms: IPM200 RP56 SPACRCAN
UniProtKB ID: Q9BZV3, A8MWT5, Q9UKD4, Q9UKK5
Gene ID:
Human(50939) Summary: The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Mouse(224224) interphotoreceptor matrix proteoglycan 2
Rat(245919) interphotoreceptor matrix proteoglycan 2
domestic guinea pig(100724750) interphotoreceptor matrix proteoglycan 2
naked mole-rat(101707642) interphotoreceptor matrix proteoglycan 2
sheep(101109327) interphotoreceptor matrix proteoglycan 2
Domestic Rabbit(100351521) interphotoreceptor matrix proteoglycan 2
chicken(418393) interphotoreceptor matrix proteoglycan 2
cow(517845) interphotoreceptor matrix proteoglycan 2
Horse(100061979) interphotoreceptor matrix proteoglycan 2
domestic cat(101099577) interphotoreceptor matrix proteoglycan 2
dog(608491) interphotoreceptor matrix proteoglycan 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016247 Rosetta Predictions human pricing
NM_139088 Rosetta Predictions rat pricing
NM_174876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243592 predicted 2351
2 SASI_Hs01_00243593 predicted 2508
3 SASI_Hs01_00243594 predicted 287
4 SASI_Hs01_00243595 predicted 2805
5 SASI_Hs01_00243596 predicted 224
6 SASI_Hs02_00349124 predicted 1472
7 SASI_Hs01_00243597 predicted 1124
8 SASI_Hs01_00243598 predicted 679
9 SASI_Hs02_00349125 predicted 1856
10 SASI_Hs01_00243599 predicted 1222
11 SASI_Hs01_00243600 predicted 2840
12 SASI_Hs01_00243601 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268453 predicted 2929
2 SASI_Rn01_00043377 predicted 380
3 SASI_Rn01_00043378 predicted 2271
4 SASI_Rn01_00043380 predicted 3325
5 SASI_Rn01_00043381 predicted 3109
6 SASI_Rn01_00043383 predicted 3378
7 SASI_Rn01_00043384 predicted 1095
8 SASI_Rn01_00043385 predicted 3347
9 SASI_Rn02_00268454 predicted 1731
10 SASI_Rn01_00043386 predicted 2522
11 SASI_Rn01_00043379 predicted 1738
12 SASI_Rn01_00043382 predicted 3174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031664 predicted 1126
2 SASI_Mm01_00031665 predicted 418
3 SASI_Mm02_00345520 predicted 3199
4 SASI_Mm01_00031666 predicted 2292
5 SASI_Mm01_00031667 predicted 1901
6 SASI_Mm01_00031668 predicted 3357
7 SASI_Mm01_00031669 predicted 3693
8 SASI_Mm01_00031670 predicted 930
9 SASI_Mm01_00031671 predicted 3292
10 SASI_Mm01_00031672 predicted 1772
11 SASI_Mm01_00031663 predicted 2246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016247
IMPG2 MISSION shRNA Bacterial Glycerol Stock
interphotoreceptor matrix proteoglycan 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016247.2-3502s21c1
Sequence:CCGGTGATCATAGGCATCACTATTGCTCGAGCAATAGTGATGCCTATGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016247.2-4166s21c1
Sequence:CCGGACGTAAACTCTGGAAAGTATTCTCGAGAATACTTTCCAGAGTTTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016247.2-3909s21c1
Sequence:CCGACAACAAGTGGAAGAGGTTTAACTCGAGTTAAACCTCTTCCACTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-1415s1c1
Sequence:CCGGGCCGTCATCTATTCTGGATAACTCGAGTTATCCAGAATAGATGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-2115s1c1
Sequence:CCGGGCTGAGATTGAAGACAAGAAACTCGAGTTTCTTGTCTTCAATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-1266s1c1
Sequence:CCGGGCTGAGACATTGCAGCAGAATCTCGAGATTCTGCTGCAATGTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-2907s1c1
Sequence:CCGGCGAGTGACTAACATGATGTTTCTCGAGAAACATCATGTTAGTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-276s1c1
Sequence:CCGGGCACAAACCTACTTATCTATACTCGAGTATAGATAAGTAGGTTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016247
IMPG2 MISSION shRNA shRNA Plasmid DNA
interphotoreceptor matrix proteoglycan 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016247.2-3502s21c1
Sequence:CCGGTGATCATAGGCATCACTATTGCTCGAGCAATAGTGATGCCTATGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016247.2-4166s21c1
Sequence:CCGGACGTAAACTCTGGAAAGTATTCTCGAGAATACTTTCCAGAGTTTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016247.2-3909s21c1
Sequence:CCGACAACAAGTGGAAGAGGTTTAACTCGAGTTAAACCTCTTCCACTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-1415s1c1
Sequence:CCGGGCCGTCATCTATTCTGGATAACTCGAGTTATCCAGAATAGATGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-2115s1c1
Sequence:CCGGGCTGAGATTGAAGACAAGAAACTCGAGTTTCTTGTCTTCAATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-1266s1c1
Sequence:CCGGGCTGAGACATTGCAGCAGAATCTCGAGATTCTGCTGCAATGTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-2907s1c1
Sequence:CCGGCGAGTGACTAACATGATGTTTCTCGAGAAACATCATGTTAGTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-276s1c1
Sequence:CCGGGCACAAACCTACTTATCTATACTCGAGTATAGATAAGTAGGTTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016247
IMPG2 MISSION shRNA Lentiviral Transduction Particles
interphotoreceptor matrix proteoglycan 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016247.2-3502s21c1
Sequence:CCGGTGATCATAGGCATCACTATTGCTCGAGCAATAGTGATGCCTATGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016247.2-4166s21c1
Sequence:CCGGACGTAAACTCTGGAAAGTATTCTCGAGAATACTTTCCAGAGTTTACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016247.2-3909s21c1
Sequence:CCGACAACAAGTGGAAGAGGTTTAACTCGAGTTAAACCTCTTCCACTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-1415s1c1
Sequence:CCGGGCCGTCATCTATTCTGGATAACTCGAGTTATCCAGAATAGATGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-2115s1c1
Sequence:CCGGGCTGAGATTGAAGACAAGAAACTCGAGTTTCTTGTCTTCAATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-1266s1c1
Sequence:CCGGGCTGAGACATTGCAGCAGAATCTCGAGATTCTGCTGCAATGTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-2907s1c1
Sequence:CCGGCGAGTGACTAACATGATGTTTCTCGAGAAACATCATGTTAGTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016247.1-276s1c1
Sequence:CCGGGCACAAACCTACTTATCTATACTCGAGTATAGATAAGTAGGTTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174876
IMPG2 MISSION shRNA Bacterial Glycerol Stock
interphotoreceptor matrix proteoglycan 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-2943s1c1
Sequence:CCGGCCGCGTGACAAACATGTTGTTCTCGAGAACAACATGTTTGTCACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174876.3-5594s1c1
Sequence:CCGGCCTCACATAATGTCAGTGATACTCGAGTATCACTGACATTATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-2944s1c1
Sequence:CCGGCGCGTGACAAACATGTTGTTTCTCGAGAAACAACATGTTTGTCACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-3417s1c1
Sequence:CCGGCGATGGAAAGTGTGACATTATCTCGAGATAATGTCACACTTTCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-438s1c1
Sequence:CCGGGCGATCTATTCTGTTCCCAAACTCGAGTTTGGGAACAGAATAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174876
IMPG2 MISSION shRNA shRNA Plasmid DNA
interphotoreceptor matrix proteoglycan 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-2943s1c1
Sequence:CCGGCCGCGTGACAAACATGTTGTTCTCGAGAACAACATGTTTGTCACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174876.3-5594s1c1
Sequence:CCGGCCTCACATAATGTCAGTGATACTCGAGTATCACTGACATTATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-2944s1c1
Sequence:CCGGCGCGTGACAAACATGTTGTTTCTCGAGAAACAACATGTTTGTCACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-3417s1c1
Sequence:CCGGCGATGGAAAGTGTGACATTATCTCGAGATAATGTCACACTTTCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-438s1c1
Sequence:CCGGGCGATCTATTCTGTTCCCAAACTCGAGTTTGGGAACAGAATAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174876
IMPG2 MISSION shRNA Lentiviral Transduction Particles
interphotoreceptor matrix proteoglycan 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-2943s1c1
Sequence:CCGGCCGCGTGACAAACATGTTGTTCTCGAGAACAACATGTTTGTCACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174876.3-5594s1c1
Sequence:CCGGCCTCACATAATGTCAGTGATACTCGAGTATCACTGACATTATGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-2944s1c1
Sequence:CCGGCGCGTGACAAACATGTTGTTTCTCGAGAAACAACATGTTTGTCACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-3417s1c1
Sequence:CCGGCGATGGAAAGTGTGACATTATCTCGAGATAATGTCACACTTTCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174876.3-438s1c1
Sequence:CCGGGCGATCTATTCTGTTCCCAAACTCGAGTTTGGGAACAGAATAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)