EMAIL THIS PAGE TO A FRIEND

INA

internexin neuronal intermediate filament protein, alpha

156 Gene Product Result for
Synonyms: NEF5 NF-66 TXBP-1
UniProtKB ID: Q16352, B1AQK0, Q9BRC5
Gene ID:
Human(9118) Summary: Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene is a member of the intermediate filament family and is involved in the morphogenesis of neurons. [provided by RefSeq, Jun 2009]
Mouse(226180) internexin neuronal intermediate filament protein, alpha
Rat(24503) internexin neuronal intermediate filament protein, alpha
sheep(101115747) internexin neuronal intermediate filament protein, alpha
domestic guinea pig(100726037) internexin neuronal intermediate filament protein, alpha
naked mole-rat(101702739) internexin neuronal intermediate filament protein, alpha
chicken(101667646) internexin neuronal intermediate filament protein, alpha
cow(532236) internexin neuronal intermediate filament protein, alpha
domestic cat(101085925) internexin neuronal intermediate filament protein, alpha
chicken(101747308) internexin neuronal intermediate filament protein, alpha
dog(486869) internexin neuronal intermediate filament protein, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032727 Rosetta Predictions human pricing
NM_019128 Rosetta Predictions rat pricing
NM_146100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100760 predicted 1976
2 SASI_Hs01_00100761 predicted 1902
3 SASI_Hs02_00360258 predicted 1753
4 SASI_Hs02_00360259 predicted 1650
5 SASI_Hs01_00100762 predicted 1998
6 SASI_Hs01_00100763 predicted 1959
7 SASI_Hs01_00100765 predicted 1750
8 SASI_Hs01_00100766 predicted 1843
9 SASI_Hs01_00100769 predicted 1837
10 SASI_Hs02_00360260 predicted 1736
11 SASI_Hs01_00100764 predicted 1923
12 SASI_Hs01_00100767 predicted 910
13 SASI_Hs01_00100768 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048382 predicted 3267
2 SASI_Rn01_00048383 predicted 3096
3 SASI_Rn01_00048384 predicted 3183
4 SASI_Rn01_00048385 predicted 3181
5 SASI_Rn01_00048386 predicted 3094
6 SASI_Rn01_00048387 predicted 3078
7 SASI_Rn01_00048388 predicted 3059
8 SASI_Rn01_00048389 predicted 2244
9 SASI_Rn01_00048390 predicted 3123
10 SASI_Rn01_00048391 predicted 3088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181086 predicted 1272
2 SASI_Mm01_00181084 predicted 1490
3 SASI_Mm02_00341739 predicted 1273
4 SASI_Mm01_00181087 predicted 1690
5 SASI_Mm01_00181083 predicted 1424
6 SASI_Mm02_00341740 predicted 1827
7 SASI_Mm02_00341741 predicted 1642
8 SASI_Mm02_00341742 predicted 1025
9 SASI_Mm02_00341743 predicted 1923
10 SASI_Mm02_00341744 predicted 1559
11 SASI_Mm01_00181085 predicted 1427
12 SASI_Mm01_00181088 predicted 978
13 SASI_Mm01_00181089 predicted 1189
14 SASI_Mm01_00181090 predicted 1589
15 SASI_Mm01_00181091 predicted 1655
16 SASI_Mm01_00181092 predicted 1558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032727
VALIDATED
INA MISSION shRNA Bacterial Glycerol Stock
internexin neuronal intermediate filament protein, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-974s1c1
Sequence:CCGGCGCGAGGAGATCCACGAGTATCTCGAGATACTCGTGGATCTCCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-307s1c1
Sequence:CCGGGTACAAGATCATCCGCACCAACTCGAGTTGGTGCGGATGATCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-1410s1c1
Sequence:CCGGAGGCATCTAAGGTAGCCTCTACTCGAGTAGAGGCTACCTTAGATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032727.2-1342s1c1
Sequence:CCGGCCTCAGTGCTACAACCTCCAACTCGAGTTGGAGGTTGTAGCACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032727.2-1129s1c1
Sequence:CCGGGCTGGAGAATGATCTGAGGAACTCGAGTTCCTCAGATCATTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-307s21c1
Sequence:CCGGGTACAAGATCATCCGCACCAACTCGAGTTGGTGCGGATGATCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1129s21c1
Sequence:CCGGGCTGGAGAATGATCTGAGGAACTCGAGTTCCTCAGATCATTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1410s21c1
Sequence:CCGGAGGCATCTAAGGTAGCCTCTACTCGAGTAGAGGCTACCTTAGATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1342s21c1
Sequence:CCGGCCTCAGTGCTACAACCTCCAACTCGAGTTGGAGGTTGTAGCACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-974s21c1
Sequence:CCGGCGCGAGGAGATCCACGAGTATCTCGAGATACTCGTGGATCTCCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032727
VALIDATED
INA MISSION shRNA shRNA Plasmid DNA
internexin neuronal intermediate filament protein, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-974s1c1
Sequence:CCGGCGCGAGGAGATCCACGAGTATCTCGAGATACTCGTGGATCTCCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-307s1c1
Sequence:CCGGGTACAAGATCATCCGCACCAACTCGAGTTGGTGCGGATGATCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-1410s1c1
Sequence:CCGGAGGCATCTAAGGTAGCCTCTACTCGAGTAGAGGCTACCTTAGATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032727.2-1342s1c1
Sequence:CCGGCCTCAGTGCTACAACCTCCAACTCGAGTTGGAGGTTGTAGCACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032727.2-1129s1c1
Sequence:CCGGGCTGGAGAATGATCTGAGGAACTCGAGTTCCTCAGATCATTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-307s21c1
Sequence:CCGGGTACAAGATCATCCGCACCAACTCGAGTTGGTGCGGATGATCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1129s21c1
Sequence:CCGGGCTGGAGAATGATCTGAGGAACTCGAGTTCCTCAGATCATTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1410s21c1
Sequence:CCGGAGGCATCTAAGGTAGCCTCTACTCGAGTAGAGGCTACCTTAGATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1342s21c1
Sequence:CCGGCCTCAGTGCTACAACCTCCAACTCGAGTTGGAGGTTGTAGCACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-974s21c1
Sequence:CCGGCGCGAGGAGATCCACGAGTATCTCGAGATACTCGTGGATCTCCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032727
VALIDATED
INA MISSION shRNA Lentiviral Transduction Particles
internexin neuronal intermediate filament protein, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-974s1c1
Sequence:CCGGCGCGAGGAGATCCACGAGTATCTCGAGATACTCGTGGATCTCCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-307s1c1
Sequence:CCGGGTACAAGATCATCCGCACCAACTCGAGTTGGTGCGGATGATCTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032727.2-1410s1c1
Sequence:CCGGAGGCATCTAAGGTAGCCTCTACTCGAGTAGAGGCTACCTTAGATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032727.2-1342s1c1
Sequence:CCGGCCTCAGTGCTACAACCTCCAACTCGAGTTGGAGGTTGTAGCACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032727.2-1129s1c1
Sequence:CCGGGCTGGAGAATGATCTGAGGAACTCGAGTTCCTCAGATCATTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-307s21c1
Sequence:CCGGGTACAAGATCATCCGCACCAACTCGAGTTGGTGCGGATGATCTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1129s21c1
Sequence:CCGGGCTGGAGAATGATCTGAGGAACTCGAGTTCCTCAGATCATTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1410s21c1
Sequence:CCGGAGGCATCTAAGGTAGCCTCTACTCGAGTAGAGGCTACCTTAGATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-1342s21c1
Sequence:CCGGCCTCAGTGCTACAACCTCCAACTCGAGTTGGAGGTTGTAGCACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032727.3-974s21c1
Sequence:CCGGCGCGAGGAGATCCACGAGTATCTCGAGATACTCGTGGATCTCCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146100
INA MISSION shRNA Bacterial Glycerol Stock
internexin neuronal intermediate filament protein, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146100.2-2056s1c1
Sequence:CCGGCCACTCTTCAATACCATAATTCTCGAGAATTATGGTATTGAAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1017s1c1
Sequence:CCGGCGTACCATTGAGATAGAGGGTCTCGAGACCCTCTATCTCAATGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1487s1c1
Sequence:CCGGAGCGGTAATATCTACGAAGAACTCGAGTTCTTCGTAGATATTACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1522s1c1
Sequence:CCGGCTACAGAAGAAAGTACCAGTTCTCGAGAACTGGTACTTTCTTCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1254s1c1
Sequence:CCGGGAAGGTAATGAGACGCGGTTTCTCGAGAAACCGCGTCTCATTACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146100
INA MISSION shRNA shRNA Plasmid DNA
internexin neuronal intermediate filament protein, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146100.2-2056s1c1
Sequence:CCGGCCACTCTTCAATACCATAATTCTCGAGAATTATGGTATTGAAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1017s1c1
Sequence:CCGGCGTACCATTGAGATAGAGGGTCTCGAGACCCTCTATCTCAATGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1487s1c1
Sequence:CCGGAGCGGTAATATCTACGAAGAACTCGAGTTCTTCGTAGATATTACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1522s1c1
Sequence:CCGGCTACAGAAGAAAGTACCAGTTCTCGAGAACTGGTACTTTCTTCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1254s1c1
Sequence:CCGGGAAGGTAATGAGACGCGGTTTCTCGAGAAACCGCGTCTCATTACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146100
INA MISSION shRNA Lentiviral Transduction Particles
internexin neuronal intermediate filament protein, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146100.2-2056s1c1
Sequence:CCGGCCACTCTTCAATACCATAATTCTCGAGAATTATGGTATTGAAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1017s1c1
Sequence:CCGGCGTACCATTGAGATAGAGGGTCTCGAGACCCTCTATCTCAATGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1487s1c1
Sequence:CCGGAGCGGTAATATCTACGAAGAACTCGAGTTCTTCGTAGATATTACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1522s1c1
Sequence:CCGGCTACAGAAGAAAGTACCAGTTCTCGAGAACTGGTACTTTCTTCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146100.2-1254s1c1
Sequence:CCGGGAAGGTAATGAGACGCGGTTTCTCGAGAAACCGCGTCTCATTACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)