EMAIL THIS PAGE TO A FRIEND

INCA1

inhibitor of CDK, cyclin A1 interacting protein 1

48 Gene Product Result for
UniProtKB ID: Q0VD86, Q6J273, Q6PKN9
Gene ID:
Mouse(103844) inhibitor of CDK, cyclin A1 interacting protein 1
Rat(360555) inhibitor of CDK, cyclin A1 interacting protein 1
domestic cat(101091318) inhibitor of CDK, cyclin A1 interacting protein 1
cow(618287) inhibitor of CDK, cyclin A1 interacting protein 1
sheep(101107802) inhibitor of CDK, cyclin A1 interacting protein 1
domestic guinea pig(100718095) inhibitor of CDK, cyclin A1 interacting protein 1
naked mole-rat(101723760) inhibitor of CDK, cyclin A1 interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_213729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_213729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_213726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213726 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213726 Rosetta Predictions human pricing
NM_001108280 Rosetta Predictions rat pricing
NM_213729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213958 predicted 1152
2 SASI_Hs01_00213959 predicted 1106
3 SASI_Hs01_00213960 predicted 908
4 SASI_Hs01_00213962 predicted 1012
5 SASI_Hs01_00213963 predicted 559
6 SASI_Hs01_00213964 predicted 765
7 SASI_Hs01_00213965 predicted 1148
8 SASI_Hs01_00213966 predicted 573
9 SASI_Hs01_00213967 predicted 759
10 SASI_Hs02_00374360 predicted 1078
11 SASI_Hs01_00213961 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237104 predicted 841
2 SASI_Rn02_00237105 predicted 483
3 SASI_Rn02_00237106 predicted 476
4 SASI_Rn02_00237107 predicted 939
5 SASI_Rn02_00237108 predicted 670
6 SASI_Rn02_00237109 predicted 628
7 SASI_Rn02_00237110 predicted 842
8 SASI_Rn02_00237111 predicted 348
9 SASI_Rn02_00237112 predicted 716
10 SASI_Rn02_00237113 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188969 predicted 719
2 SASI_Mm01_00188970 predicted 429
3 SASI_Mm01_00188971 predicted 604
4 SASI_Mm01_00188972 predicted 876
5 SASI_Mm01_00188973 predicted 774
6 SASI_Mm01_00188974 predicted 396
7 SASI_Mm01_00188975 predicted 545
8 SASI_Mm01_00188976 predicted 590
9 SASI_Mm02_00352304 predicted 396
10 SASI_Mm02_00352305 predicted 421
11 SASI_Mm01_00188977 predicted 433
12 SASI_Mm01_00188978 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213729
INCA1 MISSION shRNA Bacterial Glycerol Stock
inhibitor of CDK, cyclin A1 interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213729.1-1005s1c1
Sequence:CCGGCCAAGATCAATTCAAACATCACTCGAGTGATGTTTGAATTGATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213729.1-999s1c1
Sequence:CCGGCGGGACCCAAGATCAATTCAACTCGAGTTGAATTGATCTTGGGTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-559s1c1
Sequence:CCGGGAAGCTGCATTTGGAAAGAATCTCGAGATTCTTTCCAAATGCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-452s1c1
Sequence:CCGGGAACAGTACATTCCACCAATTCTCGAGAATTGGTGGAATGTACTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-732s1c1
Sequence:CCGGGCTTTGAACTCCTAAGCACTACTCGAGTAGTGCTTAGGAGTTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213729
INCA1 MISSION shRNA shRNA Plasmid DNA
inhibitor of CDK, cyclin A1 interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213729.1-1005s1c1
Sequence:CCGGCCAAGATCAATTCAAACATCACTCGAGTGATGTTTGAATTGATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213729.1-999s1c1
Sequence:CCGGCGGGACCCAAGATCAATTCAACTCGAGTTGAATTGATCTTGGGTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-559s1c1
Sequence:CCGGGAAGCTGCATTTGGAAAGAATCTCGAGATTCTTTCCAAATGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-452s1c1
Sequence:CCGGGAACAGTACATTCCACCAATTCTCGAGAATTGGTGGAATGTACTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-732s1c1
Sequence:CCGGGCTTTGAACTCCTAAGCACTACTCGAGTAGTGCTTAGGAGTTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213729
INCA1 MISSION shRNA Lentiviral Transduction Particles
inhibitor of CDK, cyclin A1 interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213729.1-1005s1c1
Sequence:CCGGCCAAGATCAATTCAAACATCACTCGAGTGATGTTTGAATTGATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213729.1-999s1c1
Sequence:CCGGCGGGACCCAAGATCAATTCAACTCGAGTTGAATTGATCTTGGGTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-559s1c1
Sequence:CCGGGAAGCTGCATTTGGAAAGAATCTCGAGATTCTTTCCAAATGCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-452s1c1
Sequence:CCGGGAACAGTACATTCCACCAATTCTCGAGAATTGGTGGAATGTACTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213729.1-732s1c1
Sequence:CCGGGCTTTGAACTCCTAAGCACTACTCGAGTAGTGCTTAGGAGTTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213726
INCA1 MISSION shRNA Bacterial Glycerol Stock
inhibitor of CDK, cyclin A1 interacting protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-679s1c1
Sequence:CCGGGAGGCCATGTTTGGAAGGAATCTCGAGATTCCTTCCAAACATGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213726.1-1152s1c1
Sequence:CCGGCCAAGACTAGTTCCGTCACTACTCGAGTAGTGACGGAACTAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-773s1c1
Sequence:CCGGCGTCAGAGCATCATCAACGAACTCGAGTTCGTTGATGATGCTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-569s1c1
Sequence:CCGGGTCTTCTGGAAGAACCTTAATCTCGAGATTAAGGTTCTTCCAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-553s1c1
Sequence:CCGGCCAGCGTTATGGAGATGTCTTCTCGAGAAGACATCTCCATAACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213726.2-873s21c1
Sequence:CCGGGCACCAATGAATACCCTGATCCTCGAGGATCAGGGTATTCATTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213726.2-1089s21c1
Sequence:CCGGTGGCAGCGTCTGAAGAGTAAGCTCGAGCTTACTCTTCAGACGCTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213726
INCA1 MISSION shRNA shRNA Plasmid DNA
inhibitor of CDK, cyclin A1 interacting protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-679s1c1
Sequence:CCGGGAGGCCATGTTTGGAAGGAATCTCGAGATTCCTTCCAAACATGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213726.1-1152s1c1
Sequence:CCGGCCAAGACTAGTTCCGTCACTACTCGAGTAGTGACGGAACTAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-773s1c1
Sequence:CCGGCGTCAGAGCATCATCAACGAACTCGAGTTCGTTGATGATGCTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-569s1c1
Sequence:CCGGGTCTTCTGGAAGAACCTTAATCTCGAGATTAAGGTTCTTCCAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-553s1c1
Sequence:CCGGCCAGCGTTATGGAGATGTCTTCTCGAGAAGACATCTCCATAACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213726.2-873s21c1
Sequence:CCGGGCACCAATGAATACCCTGATCCTCGAGGATCAGGGTATTCATTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213726.2-1089s21c1
Sequence:CCGGTGGCAGCGTCTGAAGAGTAAGCTCGAGCTTACTCTTCAGACGCTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213726
INCA1 MISSION shRNA Lentiviral Transduction Particles
inhibitor of CDK, cyclin A1 interacting protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-679s1c1
Sequence:CCGGGAGGCCATGTTTGGAAGGAATCTCGAGATTCCTTCCAAACATGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213726.1-1152s1c1
Sequence:CCGGCCAAGACTAGTTCCGTCACTACTCGAGTAGTGACGGAACTAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-773s1c1
Sequence:CCGGCGTCAGAGCATCATCAACGAACTCGAGTTCGTTGATGATGCTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-569s1c1
Sequence:CCGGGTCTTCTGGAAGAACCTTAATCTCGAGATTAAGGTTCTTCCAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213726.1-553s1c1
Sequence:CCGGCCAGCGTTATGGAGATGTCTTCTCGAGAAGACATCTCCATAACGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213726.2-873s21c1
Sequence:CCGGGCACCAATGAATACCCTGATCCTCGAGGATCAGGGTATTCATTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213726.2-1089s21c1
Sequence:CCGGTGGCAGCGTCTGAAGAGTAAGCTCGAGCTTACTCTTCAGACGCTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)