EMAIL THIS PAGE TO A FRIEND

INCENP

inner centromere protein antigens 135/155kDa

153 Gene Product Result for
UniProtKB ID: Q9NQS7, A8MQD2, Q5Y192
Gene ID:
Human(3619) Summary: In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]
Mouse(16319) inner centromere protein
Rat(293733) inner centromere protein
domestic guinea pig(100722610) inner centromere protein antigens 135/155kDa
naked mole-rat(101709883) inner centromere protein antigens 135/155kDa
sheep(101110982) inner centromere protein antigens 135/155kDa
fruit fly(35649) Inner centromere protein
chicken(396270) inner centromere protein antigens 135/155kDa
dog(483790) inner centromere protein antigens 135/155kDa
domestic cat(101085316) inner centromere protein antigens 135/155kDa
cow(507693) inner centromere protein antigens 135/155kDa
Horse(100059935) inner centromere protein antigens 135/155kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001891 MISSION® esiRNA esiRNA targeting human INCENP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040694 Rosetta Predictions human pricing
NM_020238 Rosetta Predictions human pricing
NM_001106335 Rosetta Predictions rat pricing
NM_016692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219348 predicted 376
2 SASI_Hs01_00219349 predicted 2761
3 SASI_Hs01_00219350 predicted 654
4 SASI_Hs01_00219351 predicted 833
5 SASI_Hs01_00219352 predicted 720
6 SASI_Hs01_00219353 predicted 391
7 SASI_Hs01_00219354 predicted 657
8 SASI_Hs01_00219355 predicted 1142
9 SASI_Hs01_00219356 predicted 446
10 SASI_Hs02_00309051 predicted 447
11 SASI_Hs01_00219357 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246791 predicted 375
2 SASI_Hs01_00246792 predicted 2741
3 SASI_Hs01_00246793 predicted 652
4 SASI_Hs01_00246794 predicted 833
5 SASI_Hs01_00246795 predicted 726
6 SASI_Hs01_00246796 predicted 399
7 SASI_Hs01_00246797 predicted 652
8 SASI_Hs01_00246798 predicted 1147
9 SASI_Hs01_00246799 predicted 447
10 SASI_Hs02_00353195 predicted 453
11 SASI_Hs01_00246800 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217958 predicted 2878
2 SASI_Rn02_00217959 predicted 1065
3 SASI_Rn02_00217960 predicted 2489
4 SASI_Rn02_00217961 predicted 1887
5 SASI_Rn02_00217962 predicted 1104
6 SASI_Rn02_00217963 predicted 1409
7 SASI_Rn02_00217964 predicted 960
8 SASI_Rn02_00217965 predicted 1648
9 SASI_Rn02_00217966 predicted 953
10 SASI_Rn02_00217967 predicted 2829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180157 predicted 1486
2 SASI_Mm01_00180155 predicted 1186
3 SASI_Mm01_00180156 predicted 712
4 SASI_Mm01_00180158 predicted 1919
5 SASI_Mm01_00180160 predicted 2679
6 SASI_Mm01_00180161 predicted 805
7 SASI_Mm01_00180164 predicted 1123
8 SASI_Mm02_00323353 predicted 349
9 SASI_Mm02_00323354 predicted 1096
10 SASI_Mm02_00323355 predicted 1473
11 SASI_Mm01_00180159 predicted 1168
12 SASI_Mm01_00180162 predicted 1374
13 SASI_Mm01_00180163 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020238
VALIDATED
INCENP MISSION shRNA Bacterial Glycerol Stock
inner centromere protein antigens 135/155kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-397s21c1
Sequence:CCGGACGGAAGAAGAGACGGATTTCCTCGAGGAAATCCGTCTCTTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-658s21c1
Sequence:CCGGGACTAAGAAGCCCGAGGATAACTCGAGTTATCCTCGGGCTTCTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020238.2-3755s21c1
Sequence:CCGGCTTGCAAGCAGCGAGATATTTCTCGAGAAATATCTCGCTGCTTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020238.1-1538s1c2
Sequence:CCGGGCAGCGTCATGAAGTCCTTTACTCGAGTAAAGGACTTCATGACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020238.1-1053s1c2
Sequence:CCGGCCGCATCATCTGTCACAGTTACTCGAGTAACTGTGACAGATGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-1742s21c1
Sequence:CCGGAGCGTCATGAAGTCCTTTATTCTCGAGAATAAAGGACTTCATGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020238.1-3111s1c1
Sequence:CCGGGCCTGCTGTTGATACCATGAACTCGAGTTCATGGTATCAACAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020238.1-635s1c1
Sequence:CCGGCGACATCAGATGAGGAATCAACTCGAGTTGATTCCTCATCTGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020238.1-208s1c1
Sequence:CCGGCGGATTTCTTATGTTCAGGATCTCGAGATCCTGAACATAAGAAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020238
VALIDATED
INCENP MISSION shRNA shRNA Plasmid DNA
inner centromere protein antigens 135/155kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-397s21c1
Sequence:CCGGACGGAAGAAGAGACGGATTTCCTCGAGGAAATCCGTCTCTTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-658s21c1
Sequence:CCGGGACTAAGAAGCCCGAGGATAACTCGAGTTATCCTCGGGCTTCTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020238.2-3755s21c1
Sequence:CCGGCTTGCAAGCAGCGAGATATTTCTCGAGAAATATCTCGCTGCTTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020238.1-1538s1c2
Sequence:CCGGGCAGCGTCATGAAGTCCTTTACTCGAGTAAAGGACTTCATGACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020238.1-1053s1c2
Sequence:CCGGCCGCATCATCTGTCACAGTTACTCGAGTAACTGTGACAGATGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-1742s21c1
Sequence:CCGGAGCGTCATGAAGTCCTTTATTCTCGAGAATAAAGGACTTCATGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020238.1-3111s1c1
Sequence:CCGGGCCTGCTGTTGATACCATGAACTCGAGTTCATGGTATCAACAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020238.1-635s1c1
Sequence:CCGGCGACATCAGATGAGGAATCAACTCGAGTTGATTCCTCATCTGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020238.1-208s1c1
Sequence:CCGGCGGATTTCTTATGTTCAGGATCTCGAGATCCTGAACATAAGAAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020238
VALIDATED
INCENP MISSION shRNA Lentiviral Transduction Particles
inner centromere protein antigens 135/155kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-397s21c1
Sequence:CCGGACGGAAGAAGAGACGGATTTCCTCGAGGAAATCCGTCTCTTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-658s21c1
Sequence:CCGGGACTAAGAAGCCCGAGGATAACTCGAGTTATCCTCGGGCTTCTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020238.2-3755s21c1
Sequence:CCGGCTTGCAAGCAGCGAGATATTTCTCGAGAAATATCTCGCTGCTTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020238.1-1538s1c2
Sequence:CCGGGCAGCGTCATGAAGTCCTTTACTCGAGTAAAGGACTTCATGACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020238.1-1053s1c2
Sequence:CCGGCCGCATCATCTGTCACAGTTACTCGAGTAACTGTGACAGATGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020238.2-1742s21c1
Sequence:CCGGAGCGTCATGAAGTCCTTTATTCTCGAGAATAAAGGACTTCATGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020238.1-3111s1c1
Sequence:CCGGGCCTGCTGTTGATACCATGAACTCGAGTTCATGGTATCAACAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020238.1-635s1c1
Sequence:CCGGCGACATCAGATGAGGAATCAACTCGAGTTGATTCCTCATCTGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020238.1-208s1c1
Sequence:CCGGCGGATTTCTTATGTTCAGGATCTCGAGATCCTGAACATAAGAAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016692
INCENP MISSION shRNA Bacterial Glycerol Stock
inner centromere protein antigens 135/155kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-1418s1c1
Sequence:CCGGCGCAGTTACAAGCAGGCAATACTCGAGTATTGCCTGCTTGTAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-1284s1c1
Sequence:CCGGCCACCAAGATTGCGATTAGTACTCGAGTACTAATCGCAATCTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-729s1c1
Sequence:CCGGCCAAGAAATCAGAGGCTGGAACTCGAGTTCCAGCCTCTGATTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016692.1-2830s1c1
Sequence:CCGGCCCATGTGTGTCTGTCTGTTTCTCGAGAAACAGACAGACACACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-2429s1c1
Sequence:CCGGCCTGTTTGTACCTCATATCAACTCGAGTTGATATGAGGTACAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016692
INCENP MISSION shRNA shRNA Plasmid DNA
inner centromere protein antigens 135/155kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-1418s1c1
Sequence:CCGGCGCAGTTACAAGCAGGCAATACTCGAGTATTGCCTGCTTGTAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-1284s1c1
Sequence:CCGGCCACCAAGATTGCGATTAGTACTCGAGTACTAATCGCAATCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-729s1c1
Sequence:CCGGCCAAGAAATCAGAGGCTGGAACTCGAGTTCCAGCCTCTGATTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016692.1-2830s1c1
Sequence:CCGGCCCATGTGTGTCTGTCTGTTTCTCGAGAAACAGACAGACACACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-2429s1c1
Sequence:CCGGCCTGTTTGTACCTCATATCAACTCGAGTTGATATGAGGTACAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016692
INCENP MISSION shRNA Lentiviral Transduction Particles
inner centromere protein antigens 135/155kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-1418s1c1
Sequence:CCGGCGCAGTTACAAGCAGGCAATACTCGAGTATTGCCTGCTTGTAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-1284s1c1
Sequence:CCGGCCACCAAGATTGCGATTAGTACTCGAGTACTAATCGCAATCTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-729s1c1
Sequence:CCGGCCAAGAAATCAGAGGCTGGAACTCGAGTTCCAGCCTCTGATTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016692.1-2830s1c1
Sequence:CCGGCCCATGTGTGTCTGTCTGTTTCTCGAGAAACAGACAGACACACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016692.1-2429s1c1
Sequence:CCGGCCTGTTTGTACCTCATATCAACTCGAGTTGATATGAGGTACAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)