EMAIL THIS PAGE TO A FRIEND

INF2

inverted formin, FH2 and WH2 domain containing

65 Gene Product Result for
Synonyms: C14orf151 C14orf173 CMTDIE FSGS5 pp9484
Gene ID:
Human(64423) Summary: This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
Mouse(70435) inverted formin, FH2 and WH2 domain containing
domestic guinea pig(100713711) inverted formin, FH2 and WH2 domain containing
naked mole-rat(101702688) inverted formin, FH2 and WH2 domain containing
sheep(101103676) inverted formin, FH2 and WH2 domain containing
chicken(423492) inverted formin, FH2 and WH2 domain containing
cow(538493) inverted formin, FH2 and WH2 domain containing
dog(490877) inverted formin, FH2 and WH2 domain containing
domestic cat(101087413) inverted formin, FH2 and WH2 domain containing
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070331 MISSION® esiRNA esiRNA targeting mouse Inf2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031714 Rosetta Predictions human pricing
NM_022489 Rosetta Predictions human pricing
NM_198411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307740 predicted 576
2 SASI_Hs02_00307741 predicted 557
3 SASI_Hs02_00307742 predicted 466
4 SASI_Hs02_00307743 predicted 452
5 SASI_Hs02_00307744 predicted 536
6 SASI_Hs02_00307745 predicted 473
7 SASI_Hs02_00307746 predicted 472
8 SASI_Hs02_00307747 predicted 442
9 SASI_Hs02_00307748 predicted 537
10 SASI_Hs02_00307749 predicted 539
11 SASI_Hs01_00210843 predicted 347
12 SASI_Hs01_00210844 predicted 241
13 SASI_Hs01_00210845 predicted 2483
14 SASI_Hs01_00210846 predicted 233
15 SASI_Hs01_00210847 predicted 930
16 SASI_Hs01_00210848 predicted 2493
17 SASI_Hs01_00210849 predicted 1295
18 SASI_Hs01_00210850 predicted 571
19 SASI_Hs01_00210851 predicted 449
20 SASI_Hs01_00210852 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355786 predicted 584
2 SASI_Hs02_00355787 predicted 555
3 SASI_Hs02_00355788 predicted 474
4 SASI_Hs02_00355789 predicted 452
5 SASI_Hs02_00355790 predicted 540
6 SASI_Hs02_00355791 predicted 475
7 SASI_Hs02_00355792 predicted 478
8 SASI_Hs02_00355793 predicted 443
9 SASI_Hs02_00355794 predicted 542
10 SASI_Hs02_00355795 predicted 533
11 SASI_Hs01_00092898 predicted 352
12 SASI_Hs01_00092899 predicted 251
13 SASI_Hs01_00092900 predicted 2540
14 SASI_Hs01_00092901 predicted 237
15 SASI_Hs01_00092902 predicted 926
16 SASI_Hs01_00092903 predicted 2548
17 SASI_Hs01_00092904 predicted 1303
18 SASI_Hs01_00092905 predicted 579
19 SASI_Hs01_00092906 predicted 442
20 SASI_Hs01_00092907 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350958 predicted 900
2 SASI_Mm01_00109845 predicted 2138
3 SASI_Mm02_00350959 predicted 897
4 SASI_Mm02_00350960 predicted 513
5 SASI_Mm01_00109846 predicted 2229
6 SASI_Mm01_00109847 predicted 3413
7 SASI_Mm01_00109848 predicted 3271
8 SASI_Mm01_00109849 predicted 2251
9 SASI_Mm02_00350961 predicted 723
10 SASI_Mm01_00109850 predicted 2892
11 SASI_Mm01_00109844 predicted 955
12 SASI_Mm01_00109851 predicted 1512
13 SASI_Mm01_00109852 predicted 1453
14 SASI_Mm01_00109853 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198411
VALIDATED
INF2 MISSION shRNA Bacterial Glycerol Stock
inverted formin, FH2 and WH2 domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-2529s1c1
Sequence:CCGGGCTATGGCTGAGTTGAGGTTACTCGAGTAACCTCAACTCAGCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198411.1-391s1c1
Sequence:CCGGCATCTTCCTGAAGCAATTTAACTCGAGTTAAATTGCTTCAGGAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-1670s1c1
Sequence:CCGGTCCTGGTATGTGGATGCCATTCTCGAGAATGGCATCCACATACCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198411.1-1780s1c1
Sequence:CCGGCCTCGAGTTCTCTAGCAATAACTCGAGTTATTGCTAGAGAACTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-989s1c1
Sequence:CCGGGCCAACCTGAAGAAGCTTCTACTCGAGTAGAAGCTTCTTCAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198411
VALIDATED
INF2 MISSION shRNA shRNA Plasmid DNA
inverted formin, FH2 and WH2 domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-2529s1c1
Sequence:CCGGGCTATGGCTGAGTTGAGGTTACTCGAGTAACCTCAACTCAGCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198411.1-391s1c1
Sequence:CCGGCATCTTCCTGAAGCAATTTAACTCGAGTTAAATTGCTTCAGGAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-1670s1c1
Sequence:CCGGTCCTGGTATGTGGATGCCATTCTCGAGAATGGCATCCACATACCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198411.1-1780s1c1
Sequence:CCGGCCTCGAGTTCTCTAGCAATAACTCGAGTTATTGCTAGAGAACTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-989s1c1
Sequence:CCGGGCCAACCTGAAGAAGCTTCTACTCGAGTAGAAGCTTCTTCAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198411
VALIDATED
INF2 MISSION shRNA Lentiviral Transduction Particles
inverted formin, FH2 and WH2 domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-2529s1c1
Sequence:CCGGGCTATGGCTGAGTTGAGGTTACTCGAGTAACCTCAACTCAGCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198411.1-391s1c1
Sequence:CCGGCATCTTCCTGAAGCAATTTAACTCGAGTTAAATTGCTTCAGGAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-1670s1c1
Sequence:CCGGTCCTGGTATGTGGATGCCATTCTCGAGAATGGCATCCACATACCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198411.1-1780s1c1
Sequence:CCGGCCTCGAGTTCTCTAGCAATAACTCGAGTTATTGCTAGAGAACTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198411.1-989s1c1
Sequence:CCGGGCCAACCTGAAGAAGCTTCTACTCGAGTAGAAGCTTCTTCAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)