EMAIL THIS PAGE TO A FRIEND

ING1

inhibitor of growth family, member 1

134 Gene Product Result for
Synonyms: p24ING1c p33 p33ING1 p33ING1b p47 p47ING1a
Gene ID:
Human(3621) Summary: This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(26356) inhibitor of growth family, member 1
Rat(306626) inhibitor of growth family, member 1
Zebrafish(678608) inhibitor of growth family, member 1
chicken(418759) inhibitor of growth family, member 1
domestic cat(101089670) inhibitor of growth family, member 1
cow(513047) inhibitor of growth family, member 1
dog(476984) inhibitor of growth family, member 1
Thale Cress(821986) PHD finger protein ING1
sheep(101116998) inhibitor of growth family, member 1
domestic guinea pig(100729016) inhibitor of growth family, member 1
naked mole-rat(101717245) inhibitor of growth family, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140461 MISSION® esiRNA esiRNA human ING1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005537 Rosetta Predictions human pricing
NM_198217 Rosetta Predictions human pricing
NM_198218 Rosetta Predictions human pricing
NM_198219 Rosetta Predictions human pricing
NM_001038591 Rosetta Predictions rat pricing
NM_011919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204088 predicted 1603
2 SASI_Hs02_00339774 predicted 1647
3 SASI_Hs01_00204089 predicted 1484
4 SASI_Hs02_00339775 predicted 1280
5 SASI_Hs01_00204090 predicted 502
6 SASI_Hs01_00204091 predicted 2133
7 SASI_Hs01_00204092 predicted 2107
8 SASI_Hs01_00204093 predicted 1941
9 SASI_Hs01_00204094 predicted 527
10 SASI_Hs01_00204095 predicted 580
11 SASI_Hs01_00204096 predicted 2161
12 SASI_Hs01_00204097 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225575 predicted 845
2 SASI_Hs01_00225576 predicted 1062
3 SASI_Hs01_00225577 predicted 729
4 SASI_Hs01_00225578 predicted 527
5 SASI_Hs01_00225579 predicted 1224
6 SASI_Hs01_00225580 predicted 1375
7 SASI_Hs01_00225581 predicted 1348
8 SASI_Hs01_00225582 predicted 1223
9 SASI_Hs01_00225583 predicted 849
10 SASI_Hs01_00225584 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079260 predicted 926
2 SASI_Hs02_00371749 predicted 972
3 SASI_Hs01_00079261 predicted 817
4 SASI_Hs02_00371750 predicted 603
5 SASI_Hs01_00079262 predicted 1456
6 SASI_Hs01_00079263 predicted 1433
7 SASI_Hs01_00079264 predicted 1263
8 SASI_Hs01_00079265 predicted 1488
9 SASI_Hs01_00079266 predicted 1304
10 SASI_Hs01_00079267 predicted 1255
11 SASI_Hs01_00079268 predicted 1144
12 SASI_Hs01_00079269 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034249 predicted 1613
2 SASI_Hs01_00034250 predicted 1829
3 SASI_Hs01_00034251 predicted 1494
4 SASI_Hs01_00034252 predicted 1292
5 SASI_Hs01_00034253 predicted 943
6 SASI_Hs01_00034254 predicted 1990
7 SASI_Hs01_00034255 predicted 942
8 SASI_Hs01_00034256 predicted 2140
9 SASI_Hs01_00034257 predicted 2114
10 SASI_Hs01_00034258 predicted 1995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086515 predicted 459
2 SASI_Rn01_00086516 predicted 500
3 SASI_Rn01_00086517 predicted 527
4 SASI_Rn01_00086518 predicted 494
5 SASI_Rn01_00086519 predicted 860
6 SASI_Rn01_00086520 predicted 893
7 SASI_Rn01_00086521 predicted 860
8 SASI_Rn01_00086522 predicted 845
9 SASI_Rn01_00086523 predicted 446
10 SASI_Rn01_00086524 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039871 predicted 1614
2 SASI_Mm01_00039872 predicted 1299
3 SASI_Mm01_00039874 predicted 1721
4 SASI_Mm01_00039875 predicted 1663
5 SASI_Mm01_00039876 predicted 1250
6 SASI_Mm01_00039877 predicted 1046
7 SASI_Mm01_00039878 predicted 1646
8 SASI_Mm01_00039879 predicted 1262
9 SASI_Mm01_00039880 predicted 1184
10 SASI_Mm02_00321744 predicted 1032
11 SASI_Mm01_00039873 predicted 1331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005537
ING1 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005537.3-2133s1c1
Sequence:CCGGGCCATGATGTATATCCATATACTCGAGTATATGGATATACATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-841s1c1
Sequence:CCGGCGCGGATTTATAGCAGTAGCACTCGAGTGCTACTGCTATAAATCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-582s1c1
Sequence:CCGGACGAGTTGATTTGAACGTCTTCTCGAGAAGACGTTCAAATCAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-1590s1c1
Sequence:CCGGCAATCATAAACCCAAGGGCAACTCGAGTTGCCCTTGGGTTTATGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-501s1c1
Sequence:CCGGGCCTAGCGCAATAACTGGTATCTCGAGATACCAGTTATTGCGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005537.3-2540s21c1
Sequence:CCGGTTGTTCCTCTAGTAGTATATTCTCGAGAATATACTACTAGAGGAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1685s21c1
Sequence:CCGGGGGCTTACAACAGGTAGTTTGCTCGAGCAAACTACCTGTTGTAAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1640s21c1
Sequence:CCGGACGAGAAGACCATGGACAAAGCTCGAGCTTTGTCCATGGTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1556s21c1
Sequence:CCGGCCATCGAGTGGTTCCACTTCTCTCGAGAGAAGTGGAACCACTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-574s21c1
Sequence:CCGGGAGGGTGGACGAGTTGATTTGCTCGAGCAAATCAACTCGTCCACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005537
ING1 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005537.3-2133s1c1
Sequence:CCGGGCCATGATGTATATCCATATACTCGAGTATATGGATATACATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-841s1c1
Sequence:CCGGCGCGGATTTATAGCAGTAGCACTCGAGTGCTACTGCTATAAATCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-582s1c1
Sequence:CCGGACGAGTTGATTTGAACGTCTTCTCGAGAAGACGTTCAAATCAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-1590s1c1
Sequence:CCGGCAATCATAAACCCAAGGGCAACTCGAGTTGCCCTTGGGTTTATGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-501s1c1
Sequence:CCGGGCCTAGCGCAATAACTGGTATCTCGAGATACCAGTTATTGCGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005537.3-2540s21c1
Sequence:CCGGTTGTTCCTCTAGTAGTATATTCTCGAGAATATACTACTAGAGGAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1685s21c1
Sequence:CCGGGGGCTTACAACAGGTAGTTTGCTCGAGCAAACTACCTGTTGTAAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1640s21c1
Sequence:CCGGACGAGAAGACCATGGACAAAGCTCGAGCTTTGTCCATGGTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1556s21c1
Sequence:CCGGCCATCGAGTGGTTCCACTTCTCTCGAGAGAAGTGGAACCACTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-574s21c1
Sequence:CCGGGAGGGTGGACGAGTTGATTTGCTCGAGCAAATCAACTCGTCCACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005537
ING1 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005537.3-2133s1c1
Sequence:CCGGGCCATGATGTATATCCATATACTCGAGTATATGGATATACATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-841s1c1
Sequence:CCGGCGCGGATTTATAGCAGTAGCACTCGAGTGCTACTGCTATAAATCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-582s1c1
Sequence:CCGGACGAGTTGATTTGAACGTCTTCTCGAGAAGACGTTCAAATCAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-1590s1c1
Sequence:CCGGCAATCATAAACCCAAGGGCAACTCGAGTTGCCCTTGGGTTTATGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005537.3-501s1c1
Sequence:CCGGGCCTAGCGCAATAACTGGTATCTCGAGATACCAGTTATTGCGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005537.3-2540s21c1
Sequence:CCGGTTGTTCCTCTAGTAGTATATTCTCGAGAATATACTACTAGAGGAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1685s21c1
Sequence:CCGGGGGCTTACAACAGGTAGTTTGCTCGAGCAAACTACCTGTTGTAAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1640s21c1
Sequence:CCGGACGAGAAGACCATGGACAAAGCTCGAGCTTTGTCCATGGTCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-1556s21c1
Sequence:CCGGCCATCGAGTGGTTCCACTTCTCTCGAGAGAAGTGGAACCACTCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005537.3-574s21c1
Sequence:CCGGGAGGGTGGACGAGTTGATTTGCTCGAGCAAATCAACTCGTCCACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011919
VALIDATED
ING1 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-1873s1c1
Sequence:CCGGGCCGCAATTTAGAAACTACAACTCGAGTTGTAGTTTCTAAATTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-966s1c1
Sequence:CCGGCGACGCCAAATACCAAGAGATCTCGAGATCTCTTGGTATTTGGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-996s1c1
Sequence:CCGGGCTGGACGACTACTATGAGAACTCGAGTTCTCATAGTAGTCGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011919.3-880s1c1
Sequence:CCGGCTGGTGAACTATGTGGAGGATCTCGAGATCCTCCACATAGTTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011919.3-1330s1c1
Sequence:CCGGGCGTCGAATAATCACGACCATCTCGAGATGGTCGTGATTATTCGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1299s21c1
Sequence:CCGGGGCAGCGAAACAATGAGAATCCTCGAGGATTCTCATTGTTTCGCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1264s21c1
Sequence:CCGGACAGGCAGATAAGCCGAATAACTCGAGTTATTCGGCTTATCTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1515s21c1
Sequence:CCGGTCGGCTGTGACAACGACGAATCTCGAGATTCGTCGTTGTCACAGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-994s21c1
Sequence:CCGGGCTGGACGACTACTATGAGAACTCGAGTTCTCATAGTAGTCGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011919.4-1871s21c1
Sequence:CCGGGCCGCAATTTAGAAACTACAACTCGAGTTGTAGTTTCTAAATTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011919
VALIDATED
ING1 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-1873s1c1
Sequence:CCGGGCCGCAATTTAGAAACTACAACTCGAGTTGTAGTTTCTAAATTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-966s1c1
Sequence:CCGGCGACGCCAAATACCAAGAGATCTCGAGATCTCTTGGTATTTGGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-996s1c1
Sequence:CCGGGCTGGACGACTACTATGAGAACTCGAGTTCTCATAGTAGTCGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011919.3-880s1c1
Sequence:CCGGCTGGTGAACTATGTGGAGGATCTCGAGATCCTCCACATAGTTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011919.3-1330s1c1
Sequence:CCGGGCGTCGAATAATCACGACCATCTCGAGATGGTCGTGATTATTCGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1299s21c1
Sequence:CCGGGGCAGCGAAACAATGAGAATCCTCGAGGATTCTCATTGTTTCGCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1264s21c1
Sequence:CCGGACAGGCAGATAAGCCGAATAACTCGAGTTATTCGGCTTATCTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1515s21c1
Sequence:CCGGTCGGCTGTGACAACGACGAATCTCGAGATTCGTCGTTGTCACAGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-994s21c1
Sequence:CCGGGCTGGACGACTACTATGAGAACTCGAGTTCTCATAGTAGTCGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011919.4-1871s21c1
Sequence:CCGGGCCGCAATTTAGAAACTACAACTCGAGTTGTAGTTTCTAAATTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011919
VALIDATED
ING1 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-1873s1c1
Sequence:CCGGGCCGCAATTTAGAAACTACAACTCGAGTTGTAGTTTCTAAATTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-966s1c1
Sequence:CCGGCGACGCCAAATACCAAGAGATCTCGAGATCTCTTGGTATTTGGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011919.3-996s1c1
Sequence:CCGGGCTGGACGACTACTATGAGAACTCGAGTTCTCATAGTAGTCGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011919.3-880s1c1
Sequence:CCGGCTGGTGAACTATGTGGAGGATCTCGAGATCCTCCACATAGTTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011919.3-1330s1c1
Sequence:CCGGGCGTCGAATAATCACGACCATCTCGAGATGGTCGTGATTATTCGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1299s21c1
Sequence:CCGGGGCAGCGAAACAATGAGAATCCTCGAGGATTCTCATTGTTTCGCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1264s21c1
Sequence:CCGGACAGGCAGATAAGCCGAATAACTCGAGTTATTCGGCTTATCTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-1515s21c1
Sequence:CCGGTCGGCTGTGACAACGACGAATCTCGAGATTCGTCGTTGTCACAGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011919.4-994s21c1
Sequence:CCGGGCTGGACGACTACTATGAGAACTCGAGTTCTCATAGTAGTCGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011919.4-1871s21c1
Sequence:CCGGGCCGCAATTTAGAAACTACAACTCGAGTTGTAGTTTCTAAATTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)