EMAIL THIS PAGE TO A FRIEND

ING2

inhibitor of growth family, member 2

51 Gene Product Result for
Synonyms: ING1L p33ING2
UniProtKB ID: Q9H160, O95698
Gene ID:
Human(3622) Summary: This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. [provided by RefSeq, Jul 2008]
Mouse(69260) inhibitor of growth family, member 2
Rat(290744) inhibitor of growth family, member 2
domestic guinea pig(100722074) inhibitor of growth family, member 2
naked mole-rat(101697629) inhibitor of growth family, member 2
sheep(101108806) inhibitor of growth family, member 2
Zebrafish(436721) inhibitor of growth family, member 2
chicken(422553) inhibitor of growth family, member 2
Thale Cress(841881) inhibitor of growth 2
cow(404141) inhibitor of growth family, member 2
domestic cat(101088158) inhibitor of growth family, member 2
dog(482916) inhibitor of growth family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001564 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001564 Rosetta Predictions human pricing
NM_001106083 Rosetta Predictions rat pricing
NM_023503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332132 predicted 848
2 SASI_Hs01_00026047 predicted 761
3 SASI_Hs01_00026048 predicted 736
4 SASI_Hs01_00026049 predicted 475
5 SASI_Hs01_00026050 predicted 636
6 SASI_Hs01_00026051 predicted 733
7 SASI_Hs01_00026053 predicted 758
8 SASI_Hs01_00026054 predicted 498
9 SASI_Hs01_00026055 predicted 340
10 SASI_Hs01_00026056 predicted 389
11 SASI_Hs01_00026052 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215462 predicted 917
2 SASI_Rn02_00215463 predicted 1044
3 SASI_Rn02_00215464 predicted 1280
4 SASI_Rn02_00215465 predicted 1351
5 SASI_Rn02_00215466 predicted 959
6 SASI_Rn02_00215467 predicted 944
7 SASI_Rn02_00215468 predicted 983
8 SASI_Rn02_00215469 predicted 1411
9 SASI_Rn02_00215470 predicted 1258
10 SASI_Rn02_00215471 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150354 predicted 1429
2 SASI_Mm01_00150355 predicted 1390
3 SASI_Mm01_00150356 predicted 1601
4 SASI_Mm01_00150357 predicted 1202
5 SASI_Mm01_00150358 predicted 987
6 SASI_Mm01_00150359 predicted 1454
7 SASI_Mm01_00150360 predicted 1303
8 SASI_Mm01_00150361 predicted 898
9 SASI_Mm01_00150362 predicted 1158
10 SASI_Mm01_00150363 predicted 1451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001564
ING2 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-383s21c1
Sequence:CCGGTTCTCCAGAGAGCACTAATTACTCGAGTAATTAGTGCTCTCTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-597s21c1
Sequence:CCGGGACCAGTGAAAGCCGTGATTTCTCGAGAAATCACGGCTTTCACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-956s21c1
Sequence:CCGGATAGAAGATCGAGGTAGTAAACTCGAGTTTACTACCTCGATCTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-695s1c1
Sequence:CCGGCCTGTTGAGTTTGCAATAGATCTCGAGATCTATTGCAAACTCAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-431s1c1
Sequence:CCGGCGGGCAAGACAAATGGAGTTACTCGAGTAACTCCATTTGTCTTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-561s1c1
Sequence:CCGGCCAGTGAAAGCCGTGATTTATCTCGAGATAAATCACGGCTTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-813s1c1
Sequence:CCGGCATGTGTTTCACTTACCTATACTCGAGTATAGGTAAGTGAAACACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-245s1c1
Sequence:CCGGCTGGACAACAAATATCAAGAACTCGAGTTCTTGATATTTGTTGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001564
ING2 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-383s21c1
Sequence:CCGGTTCTCCAGAGAGCACTAATTACTCGAGTAATTAGTGCTCTCTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-597s21c1
Sequence:CCGGGACCAGTGAAAGCCGTGATTTCTCGAGAAATCACGGCTTTCACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-956s21c1
Sequence:CCGGATAGAAGATCGAGGTAGTAAACTCGAGTTTACTACCTCGATCTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-695s1c1
Sequence:CCGGCCTGTTGAGTTTGCAATAGATCTCGAGATCTATTGCAAACTCAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-431s1c1
Sequence:CCGGCGGGCAAGACAAATGGAGTTACTCGAGTAACTCCATTTGTCTTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-561s1c1
Sequence:CCGGCCAGTGAAAGCCGTGATTTATCTCGAGATAAATCACGGCTTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-813s1c1
Sequence:CCGGCATGTGTTTCACTTACCTATACTCGAGTATAGGTAAGTGAAACACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-245s1c1
Sequence:CCGGCTGGACAACAAATATCAAGAACTCGAGTTCTTGATATTTGTTGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001564
ING2 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-383s21c1
Sequence:CCGGTTCTCCAGAGAGCACTAATTACTCGAGTAATTAGTGCTCTCTGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-597s21c1
Sequence:CCGGGACCAGTGAAAGCCGTGATTTCTCGAGAAATCACGGCTTTCACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001564.2-956s21c1
Sequence:CCGGATAGAAGATCGAGGTAGTAAACTCGAGTTTACTACCTCGATCTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-695s1c1
Sequence:CCGGCCTGTTGAGTTTGCAATAGATCTCGAGATCTATTGCAAACTCAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-431s1c1
Sequence:CCGGCGGGCAAGACAAATGGAGTTACTCGAGTAACTCCATTTGTCTTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-561s1c1
Sequence:CCGGCCAGTGAAAGCCGTGATTTATCTCGAGATAAATCACGGCTTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-813s1c1
Sequence:CCGGCATGTGTTTCACTTACCTATACTCGAGTATAGGTAAGTGAAACACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001564.1-245s1c1
Sequence:CCGGCTGGACAACAAATATCAAGAACTCGAGTTCTTGATATTTGTTGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023503
VALIDATED
ING2 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023503.2-746s1c1
Sequence:CCGGGCGTTAATCAATAGCCAAGAACTCGAGTTCTTGGCTATTGATTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023503.2-963s1c1
Sequence:CCGGGTGACTTATGTCACATGACAACTCGAGTTGTCATGTGACATAAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023503.2-1203s1c1
Sequence:CCGGCATGTGTTTCACTCACCTATACTCGAGTATAGGTGAGTGAAACACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023503.2-2044s1c1
Sequence:CCGGGCTGCCTCATATTGGCAAGATCTCGAGATCTTGCCAATATGAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023503.2-649s1c1
Sequence:CCGGCCAAGAAACGTTAAAGGAAATCTCGAGATTTCCTTTAACGTTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023503
VALIDATED
ING2 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023503.2-746s1c1
Sequence:CCGGGCGTTAATCAATAGCCAAGAACTCGAGTTCTTGGCTATTGATTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023503.2-963s1c1
Sequence:CCGGGTGACTTATGTCACATGACAACTCGAGTTGTCATGTGACATAAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023503.2-1203s1c1
Sequence:CCGGCATGTGTTTCACTCACCTATACTCGAGTATAGGTGAGTGAAACACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023503.2-2044s1c1
Sequence:CCGGGCTGCCTCATATTGGCAAGATCTCGAGATCTTGCCAATATGAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023503.2-649s1c1
Sequence:CCGGCCAAGAAACGTTAAAGGAAATCTCGAGATTTCCTTTAACGTTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023503
VALIDATED
ING2 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023503.2-746s1c1
Sequence:CCGGGCGTTAATCAATAGCCAAGAACTCGAGTTCTTGGCTATTGATTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023503.2-963s1c1
Sequence:CCGGGTGACTTATGTCACATGACAACTCGAGTTGTCATGTGACATAAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023503.2-1203s1c1
Sequence:CCGGCATGTGTTTCACTCACCTATACTCGAGTATAGGTGAGTGAAACACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023503.2-2044s1c1
Sequence:CCGGGCTGCCTCATATTGGCAAGATCTCGAGATCTTGCCAATATGAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023503.2-649s1c1
Sequence:CCGGCCAAGAAACGTTAAAGGAAATCTCGAGATTTCCTTTAACGTTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)