EMAIL THIS PAGE TO A FRIEND

ING3

inhibitor of growth family, member 3

164 Gene Product Result for
Synonyms: Eaf4 ING2 MEAF4 p47ING3
Gene ID:
Human(54556) Summary: The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(71777) inhibitor of growth family, member 3
Rat(312154) inhibitor of growth family, member 3
Zebrafish(393911) inhibitor of growth family, member 3
domestic cat(101089592) inhibitor of growth family, member 3
cow(513000) inhibitor of growth family, member 3
Horse(100056220) inhibitor of growth family, member 3
fruit fly(32853) CG6632 gene product from transcript CG6632-RA
chicken(417762) inhibitor of growth family, member 3
dog(475299) inhibitor of growth family, member 3
sheep(101102722) inhibitor of growth family, member 3
domestic guinea pig(100721269) inhibitor of growth family, member 3
naked mole-rat(101711218) inhibitor of growth family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019071 Rosetta Predictions human pricing
NM_198267 Rosetta Predictions human pricing
NM_001034107 Rosetta Predictions rat pricing
NM_023626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230128 predicted 329
2 SASI_Hs01_00230129 predicted 526
3 SASI_Hs01_00230130 predicted 497
4 SASI_Hs01_00230131 predicted 1275
5 SASI_Hs01_00230133 predicted 876
6 SASI_Hs01_00230134 predicted 714
7 SASI_Hs01_00230135 predicted 948
8 SASI_Hs01_00230136 predicted 761
9 SASI_Hs01_00230137 predicted 587
10 SASI_Hs02_00352661 predicted 232
11 SASI_Hs01_00230132 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240316 predicted 337
2 SASI_Hs01_00240319 predicted 631
3 SASI_Hs01_00240320 predicted 646
4 SASI_Hs01_00240321 predicted 229
5 SASI_Hs01_00240323 predicted 291
6 SASI_Hs01_00240324 predicted 582
7 SASI_Hs01_00240325 predicted 668
8 SASI_Hs01_00240317 predicted 368
9 SASI_Hs01_00240318 predicted 258
10 SASI_Hs01_00240322 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045870 predicted 269
2 SASI_Rn01_00045871 predicted 1451
3 SASI_Rn01_00045873 predicted 766
4 SASI_Rn02_00203941 predicted 1534
5 SASI_Rn01_00045874 predicted 1429
6 SASI_Rn01_00045875 predicted 1436
7 SASI_Rn01_00045876 predicted 411
8 SASI_Rn01_00045877 predicted 690
9 SASI_Rn01_00045878 predicted 391
10 SASI_Rn01_00045879 predicted 242
11 SASI_Rn01_00045872 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166471 predicted 354
2 SASI_Mm01_00166472 predicted 268
3 SASI_Mm01_00166473 predicted 379
4 SASI_Mm01_00166474 predicted 773
5 SASI_Mm01_00166475 predicted 548
6 SASI_Mm02_00327235 predicted 775
7 SASI_Mm01_00166476 predicted 472
8 SASI_Mm01_00166478 predicted 491
9 SASI_Mm01_00166480 predicted 896
10 SASI_Mm02_00327236 predicted 877
11 SASI_Mm01_00166477 predicted 1177
12 SASI_Mm01_00166479 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023626
VALIDATED
ING3 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1787s1c1
Sequence:CCGGGCTGTTATGTTACACTGTATACTCGAGTATACAGTGTAACATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1207s1c1
Sequence:CCGGCCTCGGTATTGCATCTGTAATCTCGAGATTACAGATGCAATACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-672s1c1
Sequence:CCGGGCTGGGTTGTCGGAACAATAACTCGAGTTATTGTTCCGACAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1182s1c1
Sequence:CCGGCGATTGGACTTACGACCCAAACTCGAGTTTGGGTCGTAAGTCCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1183s1c1
Sequence:CCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023626.4-1818s21c1
Sequence:CCGGGCTGTTATGTTACACTGTATACTCGAGTATACAGTGTAACATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-503s21c1
Sequence:CCGGATACTAGAGAGGCGATCTTTGCTCGAGCAAAGATCGCCTCTCTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-467s21c1
Sequence:CCGGATGGAGCTGGAAGCCGATAATCTCGAGATTATCGGCTTCCAGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-1214s21c1
Sequence:CCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-550s21c1
Sequence:CCGGGAACAATCACCACGCTCATTCCTCGAGGAATGAGCGTGGTGATTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023626.4-987s21c1
Sequence:CCGGCGGCACTCATGACAACCTTAACTCGAGTTAAGGTTGTCATGAGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023626
VALIDATED
ING3 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1787s1c1
Sequence:CCGGGCTGTTATGTTACACTGTATACTCGAGTATACAGTGTAACATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1207s1c1
Sequence:CCGGCCTCGGTATTGCATCTGTAATCTCGAGATTACAGATGCAATACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-672s1c1
Sequence:CCGGGCTGGGTTGTCGGAACAATAACTCGAGTTATTGTTCCGACAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1182s1c1
Sequence:CCGGCGATTGGACTTACGACCCAAACTCGAGTTTGGGTCGTAAGTCCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1183s1c1
Sequence:CCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023626.4-1818s21c1
Sequence:CCGGGCTGTTATGTTACACTGTATACTCGAGTATACAGTGTAACATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-503s21c1
Sequence:CCGGATACTAGAGAGGCGATCTTTGCTCGAGCAAAGATCGCCTCTCTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-467s21c1
Sequence:CCGGATGGAGCTGGAAGCCGATAATCTCGAGATTATCGGCTTCCAGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-1214s21c1
Sequence:CCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-550s21c1
Sequence:CCGGGAACAATCACCACGCTCATTCCTCGAGGAATGAGCGTGGTGATTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023626.4-987s21c1
Sequence:CCGGCGGCACTCATGACAACCTTAACTCGAGTTAAGGTTGTCATGAGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023626
VALIDATED
ING3 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1787s1c1
Sequence:CCGGGCTGTTATGTTACACTGTATACTCGAGTATACAGTGTAACATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1207s1c1
Sequence:CCGGCCTCGGTATTGCATCTGTAATCTCGAGATTACAGATGCAATACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-672s1c1
Sequence:CCGGGCTGGGTTGTCGGAACAATAACTCGAGTTATTGTTCCGACAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1182s1c1
Sequence:CCGGCGATTGGACTTACGACCCAAACTCGAGTTTGGGTCGTAAGTCCAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023626.3-1183s1c1
Sequence:CCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023626.4-1818s21c1
Sequence:CCGGGCTGTTATGTTACACTGTATACTCGAGTATACAGTGTAACATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-503s21c1
Sequence:CCGGATACTAGAGAGGCGATCTTTGCTCGAGCAAAGATCGCCTCTCTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-467s21c1
Sequence:CCGGATGGAGCTGGAAGCCGATAATCTCGAGATTATCGGCTTCCAGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-1214s21c1
Sequence:CCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023626.4-550s21c1
Sequence:CCGGGAACAATCACCACGCTCATTCCTCGAGGAATGAGCGTGGTGATTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023626.4-987s21c1
Sequence:CCGGCGGCACTCATGACAACCTTAACTCGAGTTAAGGTTGTCATGAGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019071
VALIDATED
ING3 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 3
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019071.2-1792s1c1
Sequence:CCGGGCTGTTATGTAACACTGTATACTCGAGTATACAGTGTTACATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-970s1c1
Sequence:CCGGCGGCACTTATGACAACATTAACTCGAGTTAATGTTGTCATAAGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-596s1c1
Sequence:CCGGCCATACGACAACAGATCATATCTCGAGATATGATCTGTTGTCGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_019071.2-859s1c1
Sequence:CCGGGACGAAGAACATCAAGTTTAACTCGAGTTAAACTTGATGTTCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-1199s1c1
Sequence:CCGGCGACCCAAATGAACCTCGATACTCGAGTATCGAGGTTCATTTGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-657s21c1
Sequence:GTACCGGCTTACGTCAGATGCCTCTAAGCTCGAGCTTAGAGGCATCTGACGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019071.2-1779s21c1
Sequence:GTACCGGACTGTACTCCAGAGCTGTTATCTCGAGATAACAGCTCTGGAGTACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-461s21c1
Sequence:GTACCGGAGCTGATAATGCTGGAATTACCTCGAGGTAATTCCAGCATTATCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_019071.2-1263s21c1
Sequence:GTACCGGGATAACCAAGATTGCCCTATACTCGAGTATAGGGCAATCTTGGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019071.2-1967s21c1
Sequence:CCGGCTAGAGTACCTGGGTACATAACTCGAGTTATGTACCCAGGTACTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-684s21c1
Sequence:CCGGACACTAGGTTGTCGAAATAATCTCGAGATTATTTCGACAACCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-597s21c1
Sequence:CCGGCATACGACAACAGATCATATTCTCGAGAATATGATCTGTTGTCGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_019071.2-375s21c1
Sequence:CCGGCAGTTGGCAAACCAGATATATCTCGAGATATATCTGGTTTGCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-882s21c1
Sequence:GTACCGGGCCAGTTATGAAGCATTTAAGCTCGAGCTTAAATGCTTCATAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-940s21c1
Sequence:GTACCGGCCAGGGAAACAGTTGGCTATTCTCGAGAATAGCCAACTGTTTCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-1188s21c1
Sequence:GTACCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-486s21c1
Sequence:GTACCGGATATTAGAGAGGCGATCTTTGCTCGAGCAAAGATCGCCTCTCTAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019071
VALIDATED
ING3 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 3
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019071.2-1792s1c1
Sequence:CCGGGCTGTTATGTAACACTGTATACTCGAGTATACAGTGTTACATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-970s1c1
Sequence:CCGGCGGCACTTATGACAACATTAACTCGAGTTAATGTTGTCATAAGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-596s1c1
Sequence:CCGGCCATACGACAACAGATCATATCTCGAGATATGATCTGTTGTCGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_019071.2-859s1c1
Sequence:CCGGGACGAAGAACATCAAGTTTAACTCGAGTTAAACTTGATGTTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-1199s1c1
Sequence:CCGGCGACCCAAATGAACCTCGATACTCGAGTATCGAGGTTCATTTGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-657s21c1
Sequence:GTACCGGCTTACGTCAGATGCCTCTAAGCTCGAGCTTAGAGGCATCTGACGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019071.2-1779s21c1
Sequence:GTACCGGACTGTACTCCAGAGCTGTTATCTCGAGATAACAGCTCTGGAGTACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-461s21c1
Sequence:GTACCGGAGCTGATAATGCTGGAATTACCTCGAGGTAATTCCAGCATTATCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_019071.2-1263s21c1
Sequence:GTACCGGGATAACCAAGATTGCCCTATACTCGAGTATAGGGCAATCTTGGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019071.2-1967s21c1
Sequence:CCGGCTAGAGTACCTGGGTACATAACTCGAGTTATGTACCCAGGTACTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-684s21c1
Sequence:CCGGACACTAGGTTGTCGAAATAATCTCGAGATTATTTCGACAACCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-597s21c1
Sequence:CCGGCATACGACAACAGATCATATTCTCGAGAATATGATCTGTTGTCGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_019071.2-375s21c1
Sequence:CCGGCAGTTGGCAAACCAGATATATCTCGAGATATATCTGGTTTGCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-882s21c1
Sequence:GTACCGGGCCAGTTATGAAGCATTTAAGCTCGAGCTTAAATGCTTCATAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-940s21c1
Sequence:GTACCGGCCAGGGAAACAGTTGGCTATTCTCGAGAATAGCCAACTGTTTCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-1188s21c1
Sequence:GTACCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-486s21c1
Sequence:GTACCGGATATTAGAGAGGCGATCTTTGCTCGAGCAAAGATCGCCTCTCTAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019071
VALIDATED
ING3 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 3
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019071.2-1792s1c1
Sequence:CCGGGCTGTTATGTAACACTGTATACTCGAGTATACAGTGTTACATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-970s1c1
Sequence:CCGGCGGCACTTATGACAACATTAACTCGAGTTAATGTTGTCATAAGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-596s1c1
Sequence:CCGGCCATACGACAACAGATCATATCTCGAGATATGATCTGTTGTCGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_019071.2-859s1c1
Sequence:CCGGGACGAAGAACATCAAGTTTAACTCGAGTTAAACTTGATGTTCTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019071.2-1199s1c1
Sequence:CCGGCGACCCAAATGAACCTCGATACTCGAGTATCGAGGTTCATTTGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-657s21c1
Sequence:GTACCGGCTTACGTCAGATGCCTCTAAGCTCGAGCTTAGAGGCATCTGACGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019071.2-1779s21c1
Sequence:GTACCGGACTGTACTCCAGAGCTGTTATCTCGAGATAACAGCTCTGGAGTACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-461s21c1
Sequence:GTACCGGAGCTGATAATGCTGGAATTACCTCGAGGTAATTCCAGCATTATCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_019071.2-1263s21c1
Sequence:GTACCGGGATAACCAAGATTGCCCTATACTCGAGTATAGGGCAATCTTGGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019071.2-1967s21c1
Sequence:CCGGCTAGAGTACCTGGGTACATAACTCGAGTTATGTACCCAGGTACTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-684s21c1
Sequence:CCGGACACTAGGTTGTCGAAATAATCTCGAGATTATTTCGACAACCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-597s21c1
Sequence:CCGGCATACGACAACAGATCATATTCTCGAGAATATGATCTGTTGTCGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_019071.2-375s21c1
Sequence:CCGGCAGTTGGCAAACCAGATATATCTCGAGATATATCTGGTTTGCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-882s21c1
Sequence:GTACCGGGCCAGTTATGAAGCATTTAAGCTCGAGCTTAAATGCTTCATAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-940s21c1
Sequence:GTACCGGCCAGGGAAACAGTTGGCTATTCTCGAGAATAGCCAACTGTTTCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-1188s21c1
Sequence:GTACCGGGATTGGACTTACGACCCAAATCTCGAGATTTGGGTCGTAAGTCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019071.2-486s21c1
Sequence:GTACCGGATATTAGAGAGGCGATCTTTGCTCGAGCAAAGATCGCCTCTCTAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)