EMAIL THIS PAGE TO A FRIEND

ING4

inhibitor of growth family, member 4

174 Gene Product Result for
Synonyms: my036 p29ING4
Gene ID:
Human(51147) Summary: This gene encodes a tumor suppressor protein that contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. Multiple alternatively spliced transcript variants have been observed that encode distinct proteins. [provided by RefSeq, Jul 2008]
Mouse(28019) inhibitor of growth family, member 4
Rat(297597) inhibitor of growth family, member 4
domestic guinea pig(100727179) inhibitor of growth family, member 4
naked mole-rat(101709506) inhibitor of growth family, member 4
sheep(101111956) inhibitor of growth family, member 4
Zebrafish(322113) inhibitor of growth family, member 4
cow(532483) inhibitor of growth family, member 4
domestic cat(101082577) inhibitor of growth family, member 4
chicken(418281) inhibitor of growth family, member 4
dog(477712) inhibitor of growth family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068581 MISSION® esiRNA esiRNA targeting mouse Ing4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127582 Rosetta Predictions human pricing
NM_001127583 Rosetta Predictions human pricing
NM_001127584 Rosetta Predictions human pricing
NM_001127585 Rosetta Predictions human pricing
NM_001127586 Rosetta Predictions human pricing
NM_016162 Rosetta Predictions human pricing
NM_001079887 Rosetta Predictions rat pricing
NM_133345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329764 predicted 1178
2 SASI_Hs02_00329765 predicted 1174
3 SASI_Hs02_00329766 predicted 1010
4 SASI_Hs02_00329767 predicted 1171
5 SASI_Hs02_00329768 predicted 985
6 SASI_Hs02_00329769 predicted 971
7 SASI_Hs02_00329770 predicted 1065
8 SASI_Hs02_00329771 predicted 1184
9 SASI_Hs02_00329772 predicted 975
10 SASI_Hs02_00329773 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329774 predicted 1170
2 SASI_Hs02_00329775 predicted 1171
3 SASI_Hs02_00329776 predicted 1001
4 SASI_Hs02_00329777 predicted 1166
5 SASI_Hs02_00329778 predicted 978
6 SASI_Hs02_00329779 predicted 965
7 SASI_Hs02_00329780 predicted 1050
8 SASI_Hs02_00329781 predicted 1167
9 SASI_Hs02_00329782 predicted 970
10 SASI_Hs02_00329783 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329784 predicted 1171
2 SASI_Hs02_00329785 predicted 1169
3 SASI_Hs02_00329786 predicted 996
4 SASI_Hs02_00329787 predicted 1166
5 SASI_Hs02_00329788 predicted 977
6 SASI_Hs02_00329789 predicted 962
7 SASI_Hs02_00329790 predicted 1050
8 SASI_Hs02_00329791 predicted 1172
9 SASI_Hs02_00329792 predicted 965
10 SASI_Hs02_00329793 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329794 predicted 1109
2 SASI_Hs02_00329795 predicted 1105
3 SASI_Hs02_00329796 predicted 939
4 SASI_Hs02_00329797 predicted 1106
5 SASI_Hs02_00329798 predicted 908
6 SASI_Hs02_00329799 predicted 899
7 SASI_Hs02_00329800 predicted 990
8 SASI_Hs02_00329801 predicted 1107
9 SASI_Hs02_00329802 predicted 908
10 SASI_Hs02_00329803 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329804 predicted 1027
2 SASI_Hs02_00329805 predicted 1029
3 SASI_Hs02_00329806 predicted 867
4 SASI_Hs02_00329807 predicted 1023
5 SASI_Hs02_00329808 predicted 841
6 SASI_Hs02_00329809 predicted 819
7 SASI_Hs02_00329810 predicted 915
8 SASI_Hs02_00329811 predicted 1029
9 SASI_Hs02_00329812 predicted 829
10 SASI_Hs02_00329813 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348971 predicted 1178
2 SASI_Hs02_00348972 predicted 1174
3 SASI_Hs02_00348973 predicted 1010
4 SASI_Hs02_00348974 predicted 1174
5 SASI_Hs01_00160319 predicted 979
6 SASI_Hs02_00348975 predicted 963
7 SASI_Hs02_00348976 predicted 1058
8 SASI_Hs01_00160322 predicted 1182
9 SASI_Hs02_00348977 predicted 975
10 SASI_Hs02_00348978 predicted 1016
11 SASI_Hs01_00160313 predicted 299
12 SASI_Hs01_00160314 predicted 971
13 SASI_Hs01_00160315 predicted 320
14 SASI_Hs01_00160316 predicted 1026
15 SASI_Hs01_00160317 predicted 304
16 SASI_Hs01_00160318 predicted 249
17 SASI_Hs01_00160320 predicted 883
18 SASI_Hs01_00160321 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208179 predicted 574
2 SASI_Rn02_00208180 predicted 616
3 SASI_Rn02_00208181 predicted 342
4 SASI_Rn02_00208182 predicted 737
5 SASI_Rn02_00208183 predicted 677
6 SASI_Rn02_00208184 predicted 1129
7 SASI_Rn02_00208185 predicted 856
8 SASI_Rn02_00208186 predicted 626
9 SASI_Rn02_00208187 predicted 212
10 SASI_Rn02_00208188 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087860 predicted 587
2 SASI_Mm01_00087862 predicted 528
3 SASI_Mm01_00087863 predicted 1223
4 SASI_Mm01_00087864 predicted 348
5 SASI_Mm02_00338517 predicted 290
6 SASI_Mm01_00087865 predicted 365
7 SASI_Mm01_00087866 predicted 689
8 SASI_Mm01_00087867 predicted 635
9 SASI_Mm01_00087868 predicted 220
10 SASI_Mm01_00087869 predicted 643
11 SASI_Mm01_00087861 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016162
VALIDATED
ING4 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-451s21c1
Sequence:CCGGAGAAAGCTGCTCGTGCTCGTTCTCGAGAACGAGCACGAGCAGCTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-115s21c1
Sequence:CCGGTTCAGCTCATGAGGGACCTAGCTCGAGCTAGGTCCCTCATGAGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-522s21c1
Sequence:CCGGTTAAAGCTCGTGCGCACAAGTCTCGAGACTTGTGCGCACGAGCTTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-268s21c1
Sequence:CCGGAGGAATTTGGTGACGACAAGGCTCGAGCCTTGTCGTCACCAAATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-676s21c1
Sequence:CCGGACAACCCTGATTGTTCCATTGCTCGAGCAATGGAACAATCAGGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-91s21c1
Sequence:CCGGTTCCCTTTGAATTACAGAGAACTCGAGTTCTCTGTAATTCAAAGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-293s21c1
Sequence:CCGGGCTTGCCATGCAGACCTATGACTCGAGTCATAGGTCTGCATGGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016162.2-133s1c1
Sequence:CCGGCCAAAGAACAGAGGACCTGAACTCGAGTTCAGGTCCTCTGTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016162.2-1528s1c1
Sequence:CCGGCGAGAACTTGTAAGTTCTCAACTCGAGTTGAGAACTTACAAGTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016162.2-1178s1c1
Sequence:CCGGGCTAGGTGTGATCAACACTTTCTCGAGAAAGTGTTGATCACACCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016162.2-617s1c1
Sequence:CCGGGAACCCACCTATTGCCTTTGTCTCGAGACAAAGGCAATAGGTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016162.3-1058s21c1
Sequence:CCGGGCTGAGGTCGGTGCTGTATTTCTCGAGAAATACAGCACCGACCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-385s21c1
Sequence:CCGGAGATTGAGTCAAGTGACTATGCTCGAGCATAGTCACTTGACTCAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016162
VALIDATED
ING4 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-451s21c1
Sequence:CCGGAGAAAGCTGCTCGTGCTCGTTCTCGAGAACGAGCACGAGCAGCTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-115s21c1
Sequence:CCGGTTCAGCTCATGAGGGACCTAGCTCGAGCTAGGTCCCTCATGAGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-522s21c1
Sequence:CCGGTTAAAGCTCGTGCGCACAAGTCTCGAGACTTGTGCGCACGAGCTTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-268s21c1
Sequence:CCGGAGGAATTTGGTGACGACAAGGCTCGAGCCTTGTCGTCACCAAATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-676s21c1
Sequence:CCGGACAACCCTGATTGTTCCATTGCTCGAGCAATGGAACAATCAGGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-91s21c1
Sequence:CCGGTTCCCTTTGAATTACAGAGAACTCGAGTTCTCTGTAATTCAAAGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-293s21c1
Sequence:CCGGGCTTGCCATGCAGACCTATGACTCGAGTCATAGGTCTGCATGGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016162.2-133s1c1
Sequence:CCGGCCAAAGAACAGAGGACCTGAACTCGAGTTCAGGTCCTCTGTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016162.2-1528s1c1
Sequence:CCGGCGAGAACTTGTAAGTTCTCAACTCGAGTTGAGAACTTACAAGTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016162.2-1178s1c1
Sequence:CCGGGCTAGGTGTGATCAACACTTTCTCGAGAAAGTGTTGATCACACCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016162.2-617s1c1
Sequence:CCGGGAACCCACCTATTGCCTTTGTCTCGAGACAAAGGCAATAGGTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016162.3-1058s21c1
Sequence:CCGGGCTGAGGTCGGTGCTGTATTTCTCGAGAAATACAGCACCGACCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-385s21c1
Sequence:CCGGAGATTGAGTCAAGTGACTATGCTCGAGCATAGTCACTTGACTCAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016162
VALIDATED
ING4 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-451s21c1
Sequence:CCGGAGAAAGCTGCTCGTGCTCGTTCTCGAGAACGAGCACGAGCAGCTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-115s21c1
Sequence:CCGGTTCAGCTCATGAGGGACCTAGCTCGAGCTAGGTCCCTCATGAGCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-522s21c1
Sequence:CCGGTTAAAGCTCGTGCGCACAAGTCTCGAGACTTGTGCGCACGAGCTTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-268s21c1
Sequence:CCGGAGGAATTTGGTGACGACAAGGCTCGAGCCTTGTCGTCACCAAATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-676s21c1
Sequence:CCGGACAACCCTGATTGTTCCATTGCTCGAGCAATGGAACAATCAGGGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-91s21c1
Sequence:CCGGTTCCCTTTGAATTACAGAGAACTCGAGTTCTCTGTAATTCAAAGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-293s21c1
Sequence:CCGGGCTTGCCATGCAGACCTATGACTCGAGTCATAGGTCTGCATGGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016162.2-133s1c1
Sequence:CCGGCCAAAGAACAGAGGACCTGAACTCGAGTTCAGGTCCTCTGTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016162.2-1528s1c1
Sequence:CCGGCGAGAACTTGTAAGTTCTCAACTCGAGTTGAGAACTTACAAGTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016162.2-1178s1c1
Sequence:CCGGGCTAGGTGTGATCAACACTTTCTCGAGAAAGTGTTGATCACACCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016162.2-617s1c1
Sequence:CCGGGAACCCACCTATTGCCTTTGTCTCGAGACAAAGGCAATAGGTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016162.3-1058s21c1
Sequence:CCGGGCTGAGGTCGGTGCTGTATTTCTCGAGAAATACAGCACCGACCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016162.3-385s21c1
Sequence:CCGGAGATTGAGTCAAGTGACTATGCTCGAGCATAGTCACTTGACTCAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133345
VALIDATED
ING4 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133345.2-1209s21c1
Sequence:CCGGTTTGGGCAGTGGCCTAGTTAACTCGAGTTAACTAGGCCACTGCCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-357s21c1
Sequence:CCGGAGATCGAGTCCAGTGACTATGCTCGAGCATAGTCACTGGACTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-141s21c1
Sequence:CCGGACAAGTTGGCCACTGAATATACTCGAGTATATTCAGTGGCCAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-759s21c1
Sequence:CCGGAGGTTTCCCTGGATTCCATTACTCGAGTAATGGAATCCAGGGAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-279s21c1
Sequence:CCGGCCTATGAGATGGTAGACAAACCTCGAGGTTTGTCTACCATCTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-65s1c1
Sequence:CCGGCCCGTTTGAATTACAGAGAAACTCGAGTTTCTCTGTAATTCAAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-226s1c1
Sequence:CCGGCCTATGGCAAGTGCAAGGAATCTCGAGATTCCTTGCACTTGCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133345.1-380s1c1
Sequence:CCGGCAGCTCTTCTAGCAAAGGCAACTCGAGTTGCCTTTGCTAGAAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133345.1-1450s1c1
Sequence:CCGGGCCAGAAATAGGACAAGACATCTCGAGATGTCTTGTCCTATTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-585s1c1
Sequence:CCGGGATCCCAACGAACCCACATATCTCGAGATATGTGGGTTCGTTGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133345
VALIDATED
ING4 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133345.2-1209s21c1
Sequence:CCGGTTTGGGCAGTGGCCTAGTTAACTCGAGTTAACTAGGCCACTGCCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-357s21c1
Sequence:CCGGAGATCGAGTCCAGTGACTATGCTCGAGCATAGTCACTGGACTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-141s21c1
Sequence:CCGGACAAGTTGGCCACTGAATATACTCGAGTATATTCAGTGGCCAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-759s21c1
Sequence:CCGGAGGTTTCCCTGGATTCCATTACTCGAGTAATGGAATCCAGGGAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-279s21c1
Sequence:CCGGCCTATGAGATGGTAGACAAACCTCGAGGTTTGTCTACCATCTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-65s1c1
Sequence:CCGGCCCGTTTGAATTACAGAGAAACTCGAGTTTCTCTGTAATTCAAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-226s1c1
Sequence:CCGGCCTATGGCAAGTGCAAGGAATCTCGAGATTCCTTGCACTTGCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133345.1-380s1c1
Sequence:CCGGCAGCTCTTCTAGCAAAGGCAACTCGAGTTGCCTTTGCTAGAAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133345.1-1450s1c1
Sequence:CCGGGCCAGAAATAGGACAAGACATCTCGAGATGTCTTGTCCTATTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-585s1c1
Sequence:CCGGGATCCCAACGAACCCACATATCTCGAGATATGTGGGTTCGTTGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133345
VALIDATED
ING4 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133345.2-1209s21c1
Sequence:CCGGTTTGGGCAGTGGCCTAGTTAACTCGAGTTAACTAGGCCACTGCCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-357s21c1
Sequence:CCGGAGATCGAGTCCAGTGACTATGCTCGAGCATAGTCACTGGACTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-141s21c1
Sequence:CCGGACAAGTTGGCCACTGAATATACTCGAGTATATTCAGTGGCCAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-759s21c1
Sequence:CCGGAGGTTTCCCTGGATTCCATTACTCGAGTAATGGAATCCAGGGAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133345.2-279s21c1
Sequence:CCGGCCTATGAGATGGTAGACAAACCTCGAGGTTTGTCTACCATCTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-65s1c1
Sequence:CCGGCCCGTTTGAATTACAGAGAAACTCGAGTTTCTCTGTAATTCAAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-226s1c1
Sequence:CCGGCCTATGGCAAGTGCAAGGAATCTCGAGATTCCTTGCACTTGCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133345.1-380s1c1
Sequence:CCGGCAGCTCTTCTAGCAAAGGCAACTCGAGTTGCCTTTGCTAGAAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133345.1-1450s1c1
Sequence:CCGGGCCAGAAATAGGACAAGACATCTCGAGATGTCTTGTCCTATTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133345.1-585s1c1
Sequence:CCGGGATCCCAACGAACCCACATATCTCGAGATATGTGGGTTCGTTGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)