EMAIL THIS PAGE TO A FRIEND

ING5

inhibitor of growth family, member 5

91 Gene Product Result for
Synonyms: p28ING5
UniProtKB ID: Q8WYH8, A8K1P3, Q53NU6, Q57Z54, Q9BS30
Gene ID:
Human(84289) Summary: The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in TP53-dependent regulatory pathway. [provided by RefSeq, Jul 2008]
Mouse(66262) inhibitor of growth family, member 5
Rat(363292) inhibitor of growth family, member 5
chicken(424852) inhibitor of growth family, member 5
dog(607562) inhibitor of growth family, member 5
cow(614733) inhibitor of growth family, member 5
domestic cat(101097828) inhibitor of growth family, member 5
sheep(101121736) inhibitor of growth family, member 5
domestic guinea pig(100722004) inhibitor of growth family, member 5
naked mole-rat(101721243) inhibitor of growth family, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032329 Rosetta Predictions human pricing
NM_001108810 Rosetta Predictions rat pricing
NM_025454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230178 predicted 820
2 SASI_Hs01_00230179 predicted 897
3 SASI_Hs01_00230180 predicted 675
4 SASI_Hs01_00230181 predicted 283
5 SASI_Hs01_00230182 predicted 493
6 SASI_Hs01_00230183 predicted 333
7 SASI_Hs01_00230184 predicted 771
8 SASI_Hs01_00230185 predicted 309
9 SASI_Hs01_00230186 predicted 762
10 SASI_Hs01_00230187 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242295 predicted 971
2 SASI_Rn02_00242296 predicted 217
3 SASI_Rn02_00242297 predicted 400
4 SASI_Rn02_00242298 predicted 271
5 SASI_Rn02_00242299 predicted 949
6 SASI_Rn02_00242300 predicted 252
7 SASI_Rn02_00242301 predicted 477
8 SASI_Rn02_00242302 predicted 877
9 SASI_Rn02_00242303 predicted 1033
10 SASI_Rn02_00242304 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135926 predicted 1021
2 SASI_Mm02_00328291 predicted 696
3 SASI_Mm01_00135927 predicted 777
4 SASI_Mm01_00135928 predicted 1029
5 SASI_Mm01_00135929 predicted 788
6 SASI_Mm01_00135930 predicted 1083
7 SASI_Mm01_00135931 predicted 307
8 SASI_Mm01_00135933 predicted 641
9 SASI_Mm01_00135934 predicted 917
10 SASI_Mm01_00135935 predicted 349
11 SASI_Mm01_00135932 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025454
VALIDATED
ING5 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-3006s1c1
Sequence:CCGGGCTGGGTTACTATGTGAGATTCTCGAGAATCTCACATAGTAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-521s1c1
Sequence:CCGGGTCTGAGTTTACTGACAGTATCTCGAGATACTGTCAGTAAACTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-179s1c1
Sequence:CCGGAGAGTATATTTCCACAGTGAACTCGAGTTCACTGTGGAAATATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-724s1c1
Sequence:CCGGGTCCACGATGTGTTCAGGAAACTCGAGTTTCCTGAACACATCGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-318s1c1
Sequence:CCGGGATAAACACATCCGAAGACTTCTCGAGAAGTCTTCGGATGTGTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025454
VALIDATED
ING5 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-3006s1c1
Sequence:CCGGGCTGGGTTACTATGTGAGATTCTCGAGAATCTCACATAGTAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-521s1c1
Sequence:CCGGGTCTGAGTTTACTGACAGTATCTCGAGATACTGTCAGTAAACTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-179s1c1
Sequence:CCGGAGAGTATATTTCCACAGTGAACTCGAGTTCACTGTGGAAATATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-724s1c1
Sequence:CCGGGTCCACGATGTGTTCAGGAAACTCGAGTTTCCTGAACACATCGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-318s1c1
Sequence:CCGGGATAAACACATCCGAAGACTTCTCGAGAAGTCTTCGGATGTGTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025454
VALIDATED
ING5 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-3006s1c1
Sequence:CCGGGCTGGGTTACTATGTGAGATTCTCGAGAATCTCACATAGTAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-521s1c1
Sequence:CCGGGTCTGAGTTTACTGACAGTATCTCGAGATACTGTCAGTAAACTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-179s1c1
Sequence:CCGGAGAGTATATTTCCACAGTGAACTCGAGTTCACTGTGGAAATATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-724s1c1
Sequence:CCGGGTCCACGATGTGTTCAGGAAACTCGAGTTTCCTGAACACATCGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025454.2-318s1c1
Sequence:CCGGGATAAACACATCCGAAGACTTCTCGAGAAGTCTTCGGATGTGTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032329
VALIDATED
ING5 MISSION shRNA Bacterial Glycerol Stock
inhibitor of growth family, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-131s1c1
Sequence:CCGGGAAGATAAGAAAGCAGAGATTCTCGAGAATCTCTGCTTTCTTATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032329.4-508s1c1
Sequence:CCGGGTCTGAGTTCACTGACACCATCTCGAGATGGTGTCAGTGAACTCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-340s1c1
Sequence:CCGGGCGCTTTGAAGCAGATCTGAACTCGAGTTCAGATCTGCTTCAAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-250s1c1
Sequence:CCGGCAAGGAATACAGTGACGACAACTCGAGTTGTCGTCACTGTATTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-56s1c1
Sequence:CCGGCTGGACAGTATCGAGAACCTTCTCGAGAAGGTTCTCGATACTGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032329.4-252s21c1
Sequence:CCGGAGGAATACAGTGACGACAAAGCTCGAGCTTTGTCGTCACTGTATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032329.4-792s21c1
Sequence:CCGGCTTCATTCGTGTCGCAATATTCTCGAGAATATTGCGACACGAATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032329.4-118s21c1
Sequence:CCGGGGACCAGAGGACGGAAGATAACTCGAGTTATCTTCCGTCCTCTGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032329.4-765s21c1
Sequence:CCGGGGATCCGAGGAGCAAGTTAATCTCGAGATTAACTTGCTCCTCGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032329
VALIDATED
ING5 MISSION shRNA shRNA Plasmid DNA
inhibitor of growth family, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-131s1c1
Sequence:CCGGGAAGATAAGAAAGCAGAGATTCTCGAGAATCTCTGCTTTCTTATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032329.4-508s1c1
Sequence:CCGGGTCTGAGTTCACTGACACCATCTCGAGATGGTGTCAGTGAACTCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-340s1c1
Sequence:CCGGGCGCTTTGAAGCAGATCTGAACTCGAGTTCAGATCTGCTTCAAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-250s1c1
Sequence:CCGGCAAGGAATACAGTGACGACAACTCGAGTTGTCGTCACTGTATTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-56s1c1
Sequence:CCGGCTGGACAGTATCGAGAACCTTCTCGAGAAGGTTCTCGATACTGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032329.4-252s21c1
Sequence:CCGGAGGAATACAGTGACGACAAAGCTCGAGCTTTGTCGTCACTGTATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032329.4-792s21c1
Sequence:CCGGCTTCATTCGTGTCGCAATATTCTCGAGAATATTGCGACACGAATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032329.4-118s21c1
Sequence:CCGGGGACCAGAGGACGGAAGATAACTCGAGTTATCTTCCGTCCTCTGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032329.4-765s21c1
Sequence:CCGGGGATCCGAGGAGCAAGTTAATCTCGAGATTAACTTGCTCCTCGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032329
VALIDATED
ING5 MISSION shRNA Lentiviral Transduction Particles
inhibitor of growth family, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-131s1c1
Sequence:CCGGGAAGATAAGAAAGCAGAGATTCTCGAGAATCTCTGCTTTCTTATCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032329.4-508s1c1
Sequence:CCGGGTCTGAGTTCACTGACACCATCTCGAGATGGTGTCAGTGAACTCAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-340s1c1
Sequence:CCGGGCGCTTTGAAGCAGATCTGAACTCGAGTTCAGATCTGCTTCAAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-250s1c1
Sequence:CCGGCAAGGAATACAGTGACGACAACTCGAGTTGTCGTCACTGTATTCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032329.4-56s1c1
Sequence:CCGGCTGGACAGTATCGAGAACCTTCTCGAGAAGGTTCTCGATACTGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032329.4-252s21c1
Sequence:CCGGAGGAATACAGTGACGACAAAGCTCGAGCTTTGTCGTCACTGTATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032329.4-792s21c1
Sequence:CCGGCTTCATTCGTGTCGCAATATTCTCGAGAATATTGCGACACGAATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032329.4-118s21c1
Sequence:CCGGGGACCAGAGGACGGAAGATAACTCGAGTTATCTTCCGTCCTCTGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032329.4-765s21c1
Sequence:CCGGGGATCCGAGGAGCAAGTTAATCTCGAGATTAACTTGCTCCTCGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)