EMAIL THIS PAGE TO A FRIEND

INHA

inhibin, alpha

62 Gene Product Result for
UniProtKB ID: P05111, A8K8H5
Gene ID:
Human(3623) Summary: This gene encodes the alpha subunit of inhibins A and B protein complexes. These complexes negatively regulate follicle stimulating hormone secretion from the pituitary gland. Inhibins have also been implicated in regulating numerous cellular processes including cell proliferation, apoptosis, immune response and hormone secretion.[provided by RefSeq, Dec 2010]
Mouse(16322) inhibin alpha
Rat(24504) inhibin alpha
Zebrafish(570520) inhibin, alpha
domestic cat(101098000) inhibin, alpha
cow(281254) inhibin, alpha
Horse(100034077) inhibin, alpha
dog(488540) inhibin, alpha
chicken(424197) inhibin, alpha
naked mole-rat(101712126) inhibin, alpha
Goat(100861261) inhibin, alpha
sheep(101118082) inhibin, alpha
sheep(443458) inhibin, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002191 Rosetta Predictions human pricing
NM_012590 Rosetta Predictions rat pricing
NM_010564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015258 predicted 1185
2 SASI_Hs01_00015260 predicted 402
3 SASI_Hs01_00015261 predicted 215
4 SASI_Hs01_00015262 predicted 825
5 SASI_Hs01_00015263 predicted 1168
6 SASI_Hs01_00015264 predicted 927
7 SASI_Hs02_00333409 predicted 992
8 SASI_Hs01_00015266 predicted 353
9 SASI_Hs01_00015267 predicted 848
10 SASI_Hs02_00333410 predicted 1167
11 SASI_Hs01_00015259 predicted 379
12 SASI_Hs01_00015265 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111399 predicted 1098
2 SASI_Rn01_00111400 predicted 1129
3 SASI_Rn02_00259735 predicted 1155
4 SASI_Rn01_00111402 predicted 1128
5 SASI_Rn01_00111405 predicted 1140
6 SASI_Rn01_00111406 predicted 1103
7 SASI_Rn01_00111407 predicted 391
8 SASI_Rn01_00111408 predicted 624
9 SASI_Rn02_00259736 predicted 1098
10 SASI_Rn02_00259737 predicted 1151
11 SASI_Rn01_00111401 predicted 283
12 SASI_Rn01_00111403 predicted 1136
13 SASI_Rn01_00111404 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028123 predicted 969
2 SASI_Mm01_00028124 predicted 269
3 SASI_Mm01_00028125 predicted 803
4 SASI_Mm01_00028126 predicted 1195
5 SASI_Mm01_00028127 predicted 1190
6 SASI_Mm01_00028128 predicted 1042
7 SASI_Mm01_00028129 predicted 1235
8 SASI_Mm01_00028130 predicted 928
9 SASI_Mm01_00028131 predicted 1221
10 SASI_Mm01_00028132 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010564
INHA MISSION shRNA Bacterial Glycerol Stock
inhibin, alpha
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-340s21c1
Sequence:CCAGATAAGGCGTCTGCCTCGAAGACTCGAGTCTTCGAGGCAGACGCCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-274s21c1
Sequence:CCGGGTGAAGGCTCTATTCCTAGATCTCGAGATCTAGGAATAGAGCCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-406s21c1
Sequence:CCGGGAAGATGTCTCCCAGGCTATCCTCGAGGATAGCCTGGGAGACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-506s1c1
Sequence:CCGGTCACTTATGTATTCCGGCCATCTCGAGATGGCCGGAATACATAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010564.3-1364s1c1
Sequence:CCGGGTAGACAGTTTCCACTTCCTTCTCGAGAAGGAAGTGGAAACTGTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-970s1c1
Sequence:CCGGGCTCTCAATATCTCCTTCCAACTCGAGTTGGAAGGAGATATTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-1206s1c1
Sequence:CCGGTGGAGGTTACTCTTTCAAGTACTCGAGTACTTGAAAGAGTAACCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-1023s1c1
Sequence:CCGGTCCCAGTTTCATCTTCCACTACTCGAGTAGTGGAAGATGAAACTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010564
INHA MISSION shRNA shRNA Plasmid DNA
inhibin, alpha
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-340s21c1
Sequence:CCAGATAAGGCGTCTGCCTCGAAGACTCGAGTCTTCGAGGCAGACGCCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-274s21c1
Sequence:CCGGGTGAAGGCTCTATTCCTAGATCTCGAGATCTAGGAATAGAGCCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-406s21c1
Sequence:CCGGGAAGATGTCTCCCAGGCTATCCTCGAGGATAGCCTGGGAGACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-506s1c1
Sequence:CCGGTCACTTATGTATTCCGGCCATCTCGAGATGGCCGGAATACATAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010564.3-1364s1c1
Sequence:CCGGGTAGACAGTTTCCACTTCCTTCTCGAGAAGGAAGTGGAAACTGTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-970s1c1
Sequence:CCGGGCTCTCAATATCTCCTTCCAACTCGAGTTGGAAGGAGATATTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-1206s1c1
Sequence:CCGGTGGAGGTTACTCTTTCAAGTACTCGAGTACTTGAAAGAGTAACCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-1023s1c1
Sequence:CCGGTCCCAGTTTCATCTTCCACTACTCGAGTAGTGGAAGATGAAACTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010564
INHA MISSION shRNA Lentiviral Transduction Particles
inhibin, alpha
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-340s21c1
Sequence:CCAGATAAGGCGTCTGCCTCGAAGACTCGAGTCTTCGAGGCAGACGCCTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-274s21c1
Sequence:CCGGGTGAAGGCTCTATTCCTAGATCTCGAGATCTAGGAATAGAGCCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010564.4-406s21c1
Sequence:CCGGGAAGATGTCTCCCAGGCTATCCTCGAGGATAGCCTGGGAGACATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-506s1c1
Sequence:CCGGTCACTTATGTATTCCGGCCATCTCGAGATGGCCGGAATACATAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010564.3-1364s1c1
Sequence:CCGGGTAGACAGTTTCCACTTCCTTCTCGAGAAGGAAGTGGAAACTGTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-970s1c1
Sequence:CCGGGCTCTCAATATCTCCTTCCAACTCGAGTTGGAAGGAGATATTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-1206s1c1
Sequence:CCGGTGGAGGTTACTCTTTCAAGTACTCGAGTACTTGAAAGAGTAACCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010564.3-1023s1c1
Sequence:CCGGTCCCAGTTTCATCTTCCACTACTCGAGTAGTGGAAGATGAAACTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002191
INHA MISSION shRNA Bacterial Glycerol Stock
inhibin, alpha
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-640s1c1
Sequence:CCGGCCCATGTCTTTGGGCCATGCTCTCGAGAGCATGGCCCAAAGACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1172s1c1
Sequence:CCGGCCTCGGATGGAGGTTACTCTTCTCGAGAAGAGTAACCTCCATCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1194s1c1
Sequence:CCGGCAAGTATGAGACAGTGCCCAACTCGAGTTGGGCACTGTCTCATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-936s1c1
Sequence:CCGGAGTAGCACTGAACATCTCCTTCTCGAGAAGGAGATGTTCAGTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1224s1c1
Sequence:CCGGGCAGCACTGTGCTTGTATCTACTCGAGTAGATACAAGCACAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002191
INHA MISSION shRNA shRNA Plasmid DNA
inhibin, alpha
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-640s1c1
Sequence:CCGGCCCATGTCTTTGGGCCATGCTCTCGAGAGCATGGCCCAAAGACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1172s1c1
Sequence:CCGGCCTCGGATGGAGGTTACTCTTCTCGAGAAGAGTAACCTCCATCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1194s1c1
Sequence:CCGGCAAGTATGAGACAGTGCCCAACTCGAGTTGGGCACTGTCTCATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-936s1c1
Sequence:CCGGAGTAGCACTGAACATCTCCTTCTCGAGAAGGAGATGTTCAGTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1224s1c1
Sequence:CCGGGCAGCACTGTGCTTGTATCTACTCGAGTAGATACAAGCACAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002191
INHA MISSION shRNA Lentiviral Transduction Particles
inhibin, alpha
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-640s1c1
Sequence:CCGGCCCATGTCTTTGGGCCATGCTCTCGAGAGCATGGCCCAAAGACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1172s1c1
Sequence:CCGGCCTCGGATGGAGGTTACTCTTCTCGAGAAGAGTAACCTCCATCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1194s1c1
Sequence:CCGGCAAGTATGAGACAGTGCCCAACTCGAGTTGGGCACTGTCTCATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-936s1c1
Sequence:CCGGAGTAGCACTGAACATCTCCTTCTCGAGAAGGAGATGTTCAGTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002191.2-1224s1c1
Sequence:CCGGGCAGCACTGTGCTTGTATCTACTCGAGTAGATACAAGCACAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)