EMAIL THIS PAGE TO A FRIEND

INHBA

inhibin, beta A

111 Gene Product Result for
Synonyms: EDF FRP
UniProtKB ID: P08476, Q14599
Gene ID:
Human(3624) Summary: The inhibin beta A subunit joins the alpha subunit to form a pituitary FSH secretion inhibitor. Inhibin has been shown to regulate gonadal stromal cell proliferation negatively and to have tumor-suppressor activity. In addition, serum levels of inhibin have been shown to reflect the size of granulosa-cell tumors and can therefore be used as a marker for primary as well as recurrent disease. Because expression in gonadal and various extragonadal tissues may vary severalfold in a tissue-specific fashion, it is proposed that inhibin may be both a growth/differentiation factor and a hormone. Furthermore, the beta A subunit forms a homodimer, activin A, and also joins with a beta B subunit to form a heterodimer, activin AB, both of which stimulate FSH secretion. Finally, it has been shown that the beta A subunit mRNA is identical to the erythroid differentiation factor subunit mRNA and that only one gene for this mRNA exists in the human genome. [provided by RefSeq, Jul 2008]
Mouse(16323) inhibin beta-A
Rat(29200) inhibin beta-A
Goat(100860960) inhibin, beta A
sheep(443524) inhibin, beta A
naked mole-rat(101704279) inhibin, beta A
chicken(396361) inhibin, beta A
cow(281867) inhibin, beta A
Horse(100034076) inhibin, beta A
domestic cat(493853) inhibin, beta A
dog(483245) inhibin, beta A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002192 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002192 Rosetta Predictions human pricing
NM_017128 Rosetta Predictions rat pricing
NM_008380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333411 predicted 705
2 SASI_Hs02_00333412 predicted 488
3 SASI_Hs01_00148395 predicted 462
4 SASI_Hs01_00148397 predicted 638
5 SASI_Hs01_00148398 predicted 649
6 SASI_Hs01_00148399 predicted 735
7 SASI_Hs01_00148400 predicted 681
8 SASI_Hs01_00148401 predicted 533
9 SASI_Hs01_00148402 predicted 614
10 SASI_Hs01_00148404 predicted 387
11 SASI_Hs01_00148396 predicted 646
12 SASI_Hs01_00148403 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117618 predicted 419
2 SASI_Rn01_00117619 predicted 331
3 SASI_Rn01_00117620 predicted 369
4 SASI_Rn01_00117621 predicted 1188
5 SASI_Rn01_00117622 predicted 455
6 SASI_Rn01_00117623 predicted 301
7 SASI_Rn02_00261367 predicted 619
8 SASI_Rn01_00117624 predicted 652
9 SASI_Rn01_00117625 predicted 600
10 SASI_Rn01_00117627 predicted 285
11 SASI_Rn01_00117626 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112852 predicted 677
2 SASI_Mm01_00112853 predicted 1184
3 SASI_Mm02_00313745 predicted 576
4 SASI_Mm02_00313746 predicted 619
5 SASI_Mm01_00112855 predicted 569
6 SASI_Mm01_00112856 predicted 311
7 SASI_Mm02_00313747 predicted 460
8 SASI_Mm01_00112859 predicted 302
9 SASI_Mm01_00112860 predicted 599
10 SASI_Mm02_00313748 predicted 1278
11 SASI_Mm01_00112854 predicted 568
12 SASI_Mm01_00112857 predicted 1200
13 SASI_Mm01_00112858 predicted 634
14 SASI_Mm01_00112861 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008380
VALIDATED
INHBA MISSION shRNA Bacterial Glycerol Stock
inhibin, beta A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008380.1-341s1c1
Sequence:CCGGGCTGTCAAGAAGCACATCTTACTCGAGTAAGATGTGCTTCTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008380.1-1266s1c1
Sequence:CCGGCCTTCCACTCAACAGTCATTACTCGAGTAATGACTGTTGAGTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-691s1c1
Sequence:CCGGCCGTCTATTTCAGCAGCAGAACTCGAGTTCTGCTGCTGAAATAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-1113s1c1
Sequence:CCGGGCAAGGTCAACATTTGCTGTACTCGAGTACAGCAAATGTTGACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-473s1c1
Sequence:CCGGGTGGAGATAGAGGACGACATTCTCGAGAATGTCGTCCTCTATCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-745s21c1
Sequence:CCGGGGCCGAGGAAATGGGCTTAAACTCGAGTTTAAGCCCATTTCCTCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-1193s21c1
Sequence:CCGGTCTGGCTATCACGCCAATTATCTCGAGATAATTGGCGTGATAGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-816s21c1
Sequence:CCGGAGAGTACCTGGCACATCTTTCCTCGAGGAAAGATGTGCCAGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-204s21c1
Sequence:CCGGTGGCAAGTTGCTGGATTATAGCTCGAGCTATAATCCAGCAACTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-1266s21c1
Sequence:CCGGCCTTCCACTCAACAGTCATTACTCGAGTAATGACTGTTGAGTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008380
VALIDATED
INHBA MISSION shRNA shRNA Plasmid DNA
inhibin, beta A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008380.1-341s1c1
Sequence:CCGGGCTGTCAAGAAGCACATCTTACTCGAGTAAGATGTGCTTCTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008380.1-1266s1c1
Sequence:CCGGCCTTCCACTCAACAGTCATTACTCGAGTAATGACTGTTGAGTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-691s1c1
Sequence:CCGGCCGTCTATTTCAGCAGCAGAACTCGAGTTCTGCTGCTGAAATAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-1113s1c1
Sequence:CCGGGCAAGGTCAACATTTGCTGTACTCGAGTACAGCAAATGTTGACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-473s1c1
Sequence:CCGGGTGGAGATAGAGGACGACATTCTCGAGAATGTCGTCCTCTATCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-745s21c1
Sequence:CCGGGGCCGAGGAAATGGGCTTAAACTCGAGTTTAAGCCCATTTCCTCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-1193s21c1
Sequence:CCGGTCTGGCTATCACGCCAATTATCTCGAGATAATTGGCGTGATAGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-816s21c1
Sequence:CCGGAGAGTACCTGGCACATCTTTCCTCGAGGAAAGATGTGCCAGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-204s21c1
Sequence:CCGGTGGCAAGTTGCTGGATTATAGCTCGAGCTATAATCCAGCAACTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-1266s21c1
Sequence:CCGGCCTTCCACTCAACAGTCATTACTCGAGTAATGACTGTTGAGTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008380
VALIDATED
INHBA MISSION shRNA Lentiviral Transduction Particles
inhibin, beta A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008380.1-341s1c1
Sequence:CCGGGCTGTCAAGAAGCACATCTTACTCGAGTAAGATGTGCTTCTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008380.1-1266s1c1
Sequence:CCGGCCTTCCACTCAACAGTCATTACTCGAGTAATGACTGTTGAGTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-691s1c1
Sequence:CCGGCCGTCTATTTCAGCAGCAGAACTCGAGTTCTGCTGCTGAAATAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-1113s1c1
Sequence:CCGGGCAAGGTCAACATTTGCTGTACTCGAGTACAGCAAATGTTGACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008380.1-473s1c1
Sequence:CCGGGTGGAGATAGAGGACGACATTCTCGAGAATGTCGTCCTCTATCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-745s21c1
Sequence:CCGGGGCCGAGGAAATGGGCTTAAACTCGAGTTTAAGCCCATTTCCTCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-1193s21c1
Sequence:CCGGTCTGGCTATCACGCCAATTATCTCGAGATAATTGGCGTGATAGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-816s21c1
Sequence:CCGGAGAGTACCTGGCACATCTTTCCTCGAGGAAAGATGTGCCAGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-204s21c1
Sequence:CCGGTGGCAAGTTGCTGGATTATAGCTCGAGCTATAATCCAGCAACTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008380.1-1266s21c1
Sequence:CCGGCCTTCCACTCAACAGTCATTACTCGAGTAATGACTGTTGAGTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002192
VALIDATED
INHBA MISSION shRNA Bacterial Glycerol Stock
inhibin, beta A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-1111s1c1
Sequence:CCGGCTCTGGCTATCATGCCAACTACTCGAGTAGTTGGCATGATAGCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-490s1c1
Sequence:CCGGGCTGCACTTCGAGATTTCCAACTCGAGTTGGAAATCTCGAAGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002192.1-331s1c1
Sequence:CCGGGCTTCTGAACGCGATCAGAAACTCGAGTTTCTGATCGCGTTCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002192.1-1273s1c1
Sequence:CCGGGAGACCCATGTCCATGTTGTACTCGAGTACAACATGGACATGGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-126s1c1
Sequence:CCGGGCTGGATTATAGTGAGGAGTTCTCGAGAACTCCTCACTATAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-549s21c1
Sequence:CCGGTGGAGATAGAGGATGACATTGCTCGAGCAATGTCATCCTCTATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-648s21c1
Sequence:CCGGAGACGCTGCACTTCGAGATTTCTCGAGAAATCTCGAAGTGCAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-606s21c1
Sequence:CCGGCCTCGGAGATCATCACGTTTGCTCGAGCAAACGTGATGATCTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-279s21c1
Sequence:CCGGTGGCAAGTTGCTGGATTATAGCTCGAGCTATAATCCAGCAACTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-1968s21c1
Sequence:CCGGAGGCACTTTCCTACCCAATTACTCGAGTAATTGGGTAGGAAAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-1200s21c1
Sequence:CCGGTCAACATCTGCTGTAAGAAACCTCGAGGTTTCTTACAGCAGATGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002192.2-1780s21c1
Sequence:CCGGGAGAATGGTGTACCCTTTATTCTCGAGAATAAAGGGTACACCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-577s21c1
Sequence:CCGGGGCAGAAATGAATGAACTTATCTCGAGATAAGTTCATTCATTTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002192
VALIDATED
INHBA MISSION shRNA shRNA Plasmid DNA
inhibin, beta A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-1111s1c1
Sequence:CCGGCTCTGGCTATCATGCCAACTACTCGAGTAGTTGGCATGATAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-490s1c1
Sequence:CCGGGCTGCACTTCGAGATTTCCAACTCGAGTTGGAAATCTCGAAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002192.1-331s1c1
Sequence:CCGGGCTTCTGAACGCGATCAGAAACTCGAGTTTCTGATCGCGTTCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002192.1-1273s1c1
Sequence:CCGGGAGACCCATGTCCATGTTGTACTCGAGTACAACATGGACATGGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-126s1c1
Sequence:CCGGGCTGGATTATAGTGAGGAGTTCTCGAGAACTCCTCACTATAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-549s21c1
Sequence:CCGGTGGAGATAGAGGATGACATTGCTCGAGCAATGTCATCCTCTATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-648s21c1
Sequence:CCGGAGACGCTGCACTTCGAGATTTCTCGAGAAATCTCGAAGTGCAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-606s21c1
Sequence:CCGGCCTCGGAGATCATCACGTTTGCTCGAGCAAACGTGATGATCTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-279s21c1
Sequence:CCGGTGGCAAGTTGCTGGATTATAGCTCGAGCTATAATCCAGCAACTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-1968s21c1
Sequence:CCGGAGGCACTTTCCTACCCAATTACTCGAGTAATTGGGTAGGAAAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-1200s21c1
Sequence:CCGGTCAACATCTGCTGTAAGAAACCTCGAGGTTTCTTACAGCAGATGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002192.2-1780s21c1
Sequence:CCGGGAGAATGGTGTACCCTTTATTCTCGAGAATAAAGGGTACACCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-577s21c1
Sequence:CCGGGGCAGAAATGAATGAACTTATCTCGAGATAAGTTCATTCATTTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002192
VALIDATED
INHBA MISSION shRNA Lentiviral Transduction Particles
inhibin, beta A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-1111s1c1
Sequence:CCGGCTCTGGCTATCATGCCAACTACTCGAGTAGTTGGCATGATAGCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-490s1c1
Sequence:CCGGGCTGCACTTCGAGATTTCCAACTCGAGTTGGAAATCTCGAAGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002192.1-331s1c1
Sequence:CCGGGCTTCTGAACGCGATCAGAAACTCGAGTTTCTGATCGCGTTCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002192.1-1273s1c1
Sequence:CCGGGAGACCCATGTCCATGTTGTACTCGAGTACAACATGGACATGGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002192.1-126s1c1
Sequence:CCGGGCTGGATTATAGTGAGGAGTTCTCGAGAACTCCTCACTATAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-549s21c1
Sequence:CCGGTGGAGATAGAGGATGACATTGCTCGAGCAATGTCATCCTCTATCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-648s21c1
Sequence:CCGGAGACGCTGCACTTCGAGATTTCTCGAGAAATCTCGAAGTGCAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-606s21c1
Sequence:CCGGCCTCGGAGATCATCACGTTTGCTCGAGCAAACGTGATGATCTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002192.2-279s21c1
Sequence:CCGGTGGCAAGTTGCTGGATTATAGCTCGAGCTATAATCCAGCAACTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-1968s21c1
Sequence:CCGGAGGCACTTTCCTACCCAATTACTCGAGTAATTGGGTAGGAAAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-1200s21c1
Sequence:CCGGTCAACATCTGCTGTAAGAAACCTCGAGGTTTCTTACAGCAGATGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002192.2-1780s21c1
Sequence:CCGGGAGAATGGTGTACCCTTTATTCTCGAGAATAAAGGGTACACCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002192.2-577s21c1
Sequence:CCGGGGCAGAAATGAATGAACTTATCTCGAGATAAGTTCATTCATTTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)