EMAIL THIS PAGE TO A FRIEND

INHBB

inhibin, beta B

137 Gene Product Result for
UniProtKB ID: P09529, Q53T31, Q8N1D3
Gene ID:
Human(3625) Summary: The inhibin beta B subunit joins the alpha subunit to form a pituitary FSH secretion inhibitor. Inhibin has been shown to regulate gonadal stromal cell proliferation negatively and to have tumour-suppressor activity. In addition, serum levels of inhibin have been shown to reflect the size of granulosa-cell tumors and can therefore be used as a marker for primary as well as recurrent disease. Because expression in gonadal and various extragonadal tissues may vary severalfold in a tissue-specific fashion, it is proposed that inhibin may be both a growth/differentiation factor and a hormone. Furthermore, the beta B subunit forms a homodimer, activin B, and also joins with the beta A subunit to form a heterodimer, activin AB, both of which stimulate FSH secretion. [provided by RefSeq, Jul 2008]
Mouse(16324) inhibin beta-B
Rat(25196) inhibin beta-B
Zebrafish(30275) inhibin, beta B
chicken(396126) inhibin, beta B
cow(530430) inhibin, beta B
domestic cat(493742) inhibin, beta B
domestic cat(101084643) inhibin, beta B
Goat(100861250) inhibin, beta B
sheep(101119286) inhibin, beta B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_148966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_148966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_148966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002193 Rosetta Predictions human pricing
XM_001053684 Rosetta Predictions rat pricing
XM_344130 Rosetta Predictions rat pricing
NM_008381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116965 predicted 1454
2 SASI_Hs01_00116966 predicted 976
3 SASI_Hs01_00116967 predicted 774
4 SASI_Hs02_00333413 predicted 629
5 SASI_Hs01_00116969 predicted 940
6 SASI_Hs02_00333414 predicted 477
7 SASI_Hs01_00116971 predicted 1354
8 SASI_Hs01_00116972 predicted 743
9 SASI_Hs01_00116973 predicted 1186
10 SASI_Hs01_00116974 predicted 1165
11 SASI_Hs01_00116968 predicted 1298
12 SASI_Hs01_00116970 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273190 predicted 1396
2 SASI_Rn02_00273191 predicted 817
3 SASI_Rn02_00273192 predicted 923
4 SASI_Rn02_00273193 predicted 1433
5 SASI_Rn02_00273194 predicted 1138
6 SASI_Rn02_00273195 predicted 515
7 SASI_Rn02_00273196 predicted 865
8 SASI_Rn02_00273197 predicted 540
9 SASI_Rn02_00273198 predicted 945
10 SASI_Rn02_00273199 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396836 predicted 814
2 SASI_Rn02_00396837 predicted 925
3 SASI_Rn02_00396838 predicted 1428
4 SASI_Rn02_00396839 predicted 1136
5 SASI_Rn02_00396840 predicted 514
6 SASI_Rn02_00396841 predicted 858
7 SASI_Rn02_00396842 predicted 538
8 SASI_Rn02_00396843 predicted 949
9 SASI_Rn02_00396844 predicted 810
10 SASI_Rn02_00396845 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313749 predicted 1643
2 SASI_Mm01_00056009 predicted 1764
3 SASI_Mm01_00056013 predicted 1702
4 SASI_Mm01_00056014 predicted 1676
5 SASI_Mm01_00056015 predicted 2103
6 SASI_Mm02_00313750 predicted 1869
7 SASI_Mm02_00313751 predicted 1642
8 SASI_Mm02_00313752 predicted 1976
9 SASI_Mm01_00056006 predicted 2084
10 SASI_Mm01_00056007 predicted 2677
11 SASI_Mm01_00056008 predicted 2878
12 SASI_Mm01_00056010 predicted 2670
13 SASI_Mm01_00056011 predicted 2237
14 SASI_Mm01_00056012 predicted 2514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002193
INHBB MISSION shRNA Bacterial Glycerol Stock
inhibin, beta B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002193.2-993s21c1
Sequence:CCGGGCTGGAACGACTGGATCATAGCTCGAGCTATGATCCAGTCGTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002193.2-1558s21c1
Sequence:CCGGCAAATGGATGCGGTGACAAATCTCGAGATTTGTCACCGCATCCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1924s1c1
Sequence:CCGGTGATGAGTACAACATCGTCAACTCGAGTTGACGATGTTGTACTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1912s1c1
Sequence:CCGGGCTGTACTTCGATGATGAGTACTCGAGTACTCATCATCGAAGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1183s1c1
Sequence:CCGGCGTTTCCGAAATCATCAGCTTCTCGAGAAGCTGATGATTTCGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1396s1c1
Sequence:CCGGCAGGTGGAACATGGTGGAGAACTCGAGTTCTCCACCATGTTCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1240s1c1
Sequence:CCGGCCTATACTTCTTCATCTCCAACTCGAGTTGGAGATGAAGAAGTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002193
INHBB MISSION shRNA shRNA Plasmid DNA
inhibin, beta B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002193.2-993s21c1
Sequence:CCGGGCTGGAACGACTGGATCATAGCTCGAGCTATGATCCAGTCGTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002193.2-1558s21c1
Sequence:CCGGCAAATGGATGCGGTGACAAATCTCGAGATTTGTCACCGCATCCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1924s1c1
Sequence:CCGGTGATGAGTACAACATCGTCAACTCGAGTTGACGATGTTGTACTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1912s1c1
Sequence:CCGGGCTGTACTTCGATGATGAGTACTCGAGTACTCATCATCGAAGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1183s1c1
Sequence:CCGGCGTTTCCGAAATCATCAGCTTCTCGAGAAGCTGATGATTTCGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1396s1c1
Sequence:CCGGCAGGTGGAACATGGTGGAGAACTCGAGTTCTCCACCATGTTCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1240s1c1
Sequence:CCGGCCTATACTTCTTCATCTCCAACTCGAGTTGGAGATGAAGAAGTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002193
INHBB MISSION shRNA Lentiviral Transduction Particles
inhibin, beta B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002193.2-993s21c1
Sequence:CCGGGCTGGAACGACTGGATCATAGCTCGAGCTATGATCCAGTCGTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002193.2-1558s21c1
Sequence:CCGGCAAATGGATGCGGTGACAAATCTCGAGATTTGTCACCGCATCCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1924s1c1
Sequence:CCGGTGATGAGTACAACATCGTCAACTCGAGTTGACGATGTTGTACTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1912s1c1
Sequence:CCGGGCTGTACTTCGATGATGAGTACTCGAGTACTCATCATCGAAGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1183s1c1
Sequence:CCGGCGTTTCCGAAATCATCAGCTTCTCGAGAAGCTGATGATTTCGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1396s1c1
Sequence:CCGGCAGGTGGAACATGGTGGAGAACTCGAGTTCTCCACCATGTTCCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002193.1-1240s1c1
Sequence:CCGGCCTATACTTCTTCATCTCCAACTCGAGTTGGAGATGAAGAAGTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_148966
INHBB MISSION shRNA Bacterial Glycerol Stock
inhibin, beta B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-954s1c1
Sequence:CCGGGCAACAGTTCTTCATCGACTTCTCGAGAAGTCGATGAAGAACTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-634s1c1
Sequence:CCGGGTCAAGGTGTACTTCCAAGAACTCGAGTTCTTGGAAGTACACCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-1185s1c1
Sequence:CCGGGCTCTACTTTGATGACGAGTACTCGAGTACTCGTCATCAAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_148966.5-2854s1c1
Sequence:CCGGCCAGTGTTTCAGGGTATAAATCTCGAGATTTATACCCTGAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-512s1c1
Sequence:CCGGGCCTGTACTTCTTCGTCTCTACTCGAGTAGAGACGAAGAAGTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_148966
INHBB MISSION shRNA shRNA Plasmid DNA
inhibin, beta B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-954s1c1
Sequence:CCGGGCAACAGTTCTTCATCGACTTCTCGAGAAGTCGATGAAGAACTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-634s1c1
Sequence:CCGGGTCAAGGTGTACTTCCAAGAACTCGAGTTCTTGGAAGTACACCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-1185s1c1
Sequence:CCGGGCTCTACTTTGATGACGAGTACTCGAGTACTCGTCATCAAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_148966.5-2854s1c1
Sequence:CCGGCCAGTGTTTCAGGGTATAAATCTCGAGATTTATACCCTGAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-512s1c1
Sequence:CCGGGCCTGTACTTCTTCGTCTCTACTCGAGTAGAGACGAAGAAGTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_148966
INHBB MISSION shRNA Lentiviral Transduction Particles
inhibin, beta B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-954s1c1
Sequence:CCGGGCAACAGTTCTTCATCGACTTCTCGAGAAGTCGATGAAGAACTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-634s1c1
Sequence:CCGGGTCAAGGTGTACTTCCAAGAACTCGAGTTCTTGGAAGTACACCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-1185s1c1
Sequence:CCGGGCTCTACTTTGATGACGAGTACTCGAGTACTCGTCATCAAAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_148966.5-2854s1c1
Sequence:CCGGCCAGTGTTTCAGGGTATAAATCTCGAGATTTATACCCTGAAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148966.5-512s1c1
Sequence:CCGGGCCTGTACTTCTTCGTCTCTACTCGAGTAGAGACGAAGAAGTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)