EMAIL THIS PAGE TO A FRIEND

INHBC

inhibin, beta C

49 Gene Product Result for
Synonyms: IHBC
UniProtKB ID: P55103, A1L3Y2
Gene ID:
Human(3626) Summary: This gene encodes the beta C chain of inhibin, a member of the TGF-beta superfamily. This subunit forms heterodimers with beta A and beta B subunits. Inhibins and activins, also members of the TGF-beta superfamily, are hormones with opposing actions and are involved in hypothalamic, pituitary, and gonadal hormone secretion, as well as growth and differentiation of various cell types. [provided by RefSeq, Jul 2008]
Mouse(16325) inhibin beta-C
Rat(64549) inhibin beta C
sheep(101121843) inhibin, beta C
naked mole-rat(101718626) inhibin, beta C
dog(607422) inhibin, beta C
domestic cat(101092197) inhibin, beta C
cow(530785) inhibin, beta C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005538 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005538 Rosetta Predictions human pricing
NM_022614 Rosetta Predictions rat pricing
NM_010565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145119 predicted 562
2 SASI_Hs01_00145121 predicted 515
3 SASI_Hs01_00145122 predicted 1178
4 SASI_Hs01_00145123 predicted 895
5 SASI_Hs01_00145124 predicted 890
6 SASI_Hs02_00339776 predicted 1271
7 SASI_Hs01_00145125 predicted 1127
8 SASI_Hs01_00145126 predicted 472
9 SASI_Hs01_00145127 predicted 1175
10 SASI_Hs01_00145128 predicted 1232
11 SASI_Hs01_00145120 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090683 predicted 1365
2 SASI_Rn01_00090684 predicted 435
3 SASI_Rn01_00090685 predicted 1433
4 SASI_Rn01_00090687 predicted 1138
5 SASI_Rn01_00090688 predicted 416
6 SASI_Rn01_00090689 predicted 1090
7 SASI_Rn02_00263381 predicted 1240
8 SASI_Rn01_00090691 predicted 1295
9 SASI_Rn01_00090692 predicted 852
10 SASI_Rn02_00263382 predicted 545
11 SASI_Rn01_00090686 predicted 1449
12 SASI_Rn01_00090690 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090089 predicted 1040
2 SASI_Mm02_00318841 predicted 441
3 SASI_Mm01_00090090 predicted 812
4 SASI_Mm01_00090091 predicted 1092
5 SASI_Mm01_00090092 predicted 784
6 SASI_Mm01_00090094 predicted 401
7 SASI_Mm01_00090095 predicted 665
8 SASI_Mm01_00090096 predicted 497
9 SASI_Mm02_00318842 predicted 1090
10 SASI_Mm01_00090097 predicted 882
11 SASI_Mm01_00090093 predicted 1185
12 SASI_Mm01_00090098 predicted 824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005538
INHBC MISSION shRNA Bacterial Glycerol Stock
inhibin, beta C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1021s1c1
Sequence:CCGGGCTCAATCTTCTCAAGGCCAACTCGAGTTGGCCTTGAGAAGATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1138s1c1
Sequence:CCGGCAAGACTGACATACCTGACATCTCGAGATGTCAGGTATGTCAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-453s1c1
Sequence:CCGGTCAACCAGACTCGTCTTGATTCTCGAGAATCAAGACGAGTCTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1111s1c1
Sequence:CCGGCTATTATGACAGGGACAGCAACTCGAGTTGCTGTCCCTGTCATAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-518s1c1
Sequence:CCGGCAGGCCAGTCTCATGTTCTTTCTCGAGAAAGAACATGAGACTGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005538
INHBC MISSION shRNA shRNA Plasmid DNA
inhibin, beta C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1021s1c1
Sequence:CCGGGCTCAATCTTCTCAAGGCCAACTCGAGTTGGCCTTGAGAAGATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1138s1c1
Sequence:CCGGCAAGACTGACATACCTGACATCTCGAGATGTCAGGTATGTCAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-453s1c1
Sequence:CCGGTCAACCAGACTCGTCTTGATTCTCGAGAATCAAGACGAGTCTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1111s1c1
Sequence:CCGGCTATTATGACAGGGACAGCAACTCGAGTTGCTGTCCCTGTCATAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-518s1c1
Sequence:CCGGCAGGCCAGTCTCATGTTCTTTCTCGAGAAAGAACATGAGACTGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005538
INHBC MISSION shRNA Lentiviral Transduction Particles
inhibin, beta C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1021s1c1
Sequence:CCGGGCTCAATCTTCTCAAGGCCAACTCGAGTTGGCCTTGAGAAGATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1138s1c1
Sequence:CCGGCAAGACTGACATACCTGACATCTCGAGATGTCAGGTATGTCAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-453s1c1
Sequence:CCGGTCAACCAGACTCGTCTTGATTCTCGAGAATCAAGACGAGTCTGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-1111s1c1
Sequence:CCGGCTATTATGACAGGGACAGCAACTCGAGTTGCTGTCCCTGTCATAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005538.2-518s1c1
Sequence:CCGGCAGGCCAGTCTCATGTTCTTTCTCGAGAAAGAACATGAGACTGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010565
INHBC MISSION shRNA Bacterial Glycerol Stock
inhibin, beta C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-529s1c1
Sequence:CCGGCCTCACCTTGACAAGTCAGTACTCGAGTACTGACTTGTCAAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-1016s1c1
Sequence:CCGGCCTCTGTCTTTGCTCTACTATCTCGAGATAGTAGAGCAAAGACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-1047s1c1
Sequence:CCGGGCAACATTGTCAAGACGGATACTCGAGTATCCGTCTTGACAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-172s1c1
Sequence:CCGGGCTTCTCGATTTGGCCAAGAACTCGAGTTCTTGGCCAAATCGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-476s1c1
Sequence:CCGGGCCACCCAGACCATGAATATACTCGAGTATATTCATGGTCTGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010565
INHBC MISSION shRNA shRNA Plasmid DNA
inhibin, beta C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-529s1c1
Sequence:CCGGCCTCACCTTGACAAGTCAGTACTCGAGTACTGACTTGTCAAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-1016s1c1
Sequence:CCGGCCTCTGTCTTTGCTCTACTATCTCGAGATAGTAGAGCAAAGACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-1047s1c1
Sequence:CCGGGCAACATTGTCAAGACGGATACTCGAGTATCCGTCTTGACAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-172s1c1
Sequence:CCGGGCTTCTCGATTTGGCCAAGAACTCGAGTTCTTGGCCAAATCGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-476s1c1
Sequence:CCGGGCCACCCAGACCATGAATATACTCGAGTATATTCATGGTCTGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010565
INHBC MISSION shRNA Lentiviral Transduction Particles
inhibin, beta C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-529s1c1
Sequence:CCGGCCTCACCTTGACAAGTCAGTACTCGAGTACTGACTTGTCAAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-1016s1c1
Sequence:CCGGCCTCTGTCTTTGCTCTACTATCTCGAGATAGTAGAGCAAAGACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-1047s1c1
Sequence:CCGGGCAACATTGTCAAGACGGATACTCGAGTATCCGTCTTGACAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-172s1c1
Sequence:CCGGGCTTCTCGATTTGGCCAAGAACTCGAGTTCTTGGCCAAATCGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010565.2-476s1c1
Sequence:CCGGGCCACCCAGACCATGAATATACTCGAGTATATTCATGGTCTGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)