EMAIL THIS PAGE TO A FRIEND

INHBE

inhibin, beta E

117 Gene Product Result for
UniProtKB ID: P58166
Gene ID:
Human(83729) Summary: INHBE is a member of the activin beta family (see INHBA; MIM 147290) that plays a role in pancreatic exocrine cell growth and proliferation (Hashimoto et al., 2006 [PubMed 16426570]
Mouse(16326) inhibin beta E
Rat(83711) inhibin beta E
dog(607516) inhibin, beta E
cow(517587) inhibin, beta E
domestic cat(101092447) inhibin, beta E
naked mole-rat(101718273) inhibin, beta E
sheep(101121588) inhibin, beta E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031479 Rosetta Predictions human pricing
NM_031815 Rosetta Predictions rat pricing
NM_008382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232537 predicted 1414
2 SASI_Hs01_00232538 predicted 1648
3 SASI_Hs01_00232539 predicted 766
4 SASI_Hs01_00232540 predicted 499
5 SASI_Hs01_00232541 predicted 1417
6 SASI_Hs01_00232542 predicted 1481
7 SASI_Hs01_00232543 predicted 1084
8 SASI_Hs01_00232544 predicted 1486
9 SASI_Hs01_00232545 predicted 447
10 SASI_Hs01_00232546 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265277 predicted 516
2 SASI_Rn02_00265278 predicted 462
3 SASI_Rn02_00265279 predicted 274
4 SASI_Rn01_00039741 predicted 412
5 SASI_Rn01_00039745 predicted 258
6 SASI_Rn02_00265280 predicted 212
7 SASI_Rn02_00265281 predicted 466
8 SASI_Rn02_00265282 predicted 467
9 SASI_Rn02_00265283 predicted 324
10 SASI_Rn02_00265284 predicted 652
11 SASI_Rn01_00039739 predicted 662
12 SASI_Rn01_00039740 predicted 1426
13 SASI_Rn01_00039742 predicted 1262
14 SASI_Rn01_00039743 predicted 731
15 SASI_Rn01_00039744 predicted 1414
16 SASI_Rn01_00039746 predicted 1320
17 SASI_Rn01_00039747 predicted 1332
18 SASI_Rn01_00039748 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101237 predicted 1441
2 SASI_Mm02_00313753 predicted 490
3 SASI_Mm01_00101239 predicted 394
4 SASI_Mm01_00101240 predicted 1432
5 SASI_Mm02_00313754 predicted 1369
6 SASI_Mm02_00313755 predicted 1372
7 SASI_Mm01_00101242 predicted 1450
8 SASI_Mm01_00101244 predicted 772
9 SASI_Mm01_00101245 predicted 1220
10 SASI_Mm02_00313756 predicted 1472
11 SASI_Mm01_00101236 predicted 489
12 SASI_Mm01_00101238 predicted 1349
13 SASI_Mm01_00101241 predicted 772
14 SASI_Mm01_00101243 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008382
INHBE MISSION shRNA Bacterial Glycerol Stock
inhibin, beta E
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008382.1-1597s1c1
Sequence:CCGGCCCGAGAAAGAAGTTCCTCAACTCGAGTTGAGGAACTTCTTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-1093s1c1
Sequence:CCGGCCTTCCATTCTGCCGTCTTTACTCGAGTAAAGACGGCAGAATGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-768s1c1
Sequence:CCGGGTCGTGAAACTCCAACTGGAACTCGAGTTCCAGTTGGAGTTTCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-1188s1c1
Sequence:CCGGCTCCTCTACCTTGACCATAATCTCGAGATTATGGTCAAGGTAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-480s1c1
Sequence:CCGGCGAGAGAAAGTCATCAGCTTTCTCGAGAAAGCTGATGACTTTCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008382.2-1643s21c1
Sequence:CCGGAGTAGAAGGGTGGGCAGATTACTCGAGTAATCTGCCCACCCTTCTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008382.2-872s21c1
Sequence:CCGGACGTCCCTTCTTGGAACTTAACTCGAGTTAAGTTCCAAGAAGGGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008382.2-396s21c1
Sequence:CCGGCTAACCAGCCGTCCCAGAATACTCGAGTATTCTGGGACGGCTGGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008382
INHBE MISSION shRNA shRNA Plasmid DNA
inhibin, beta E
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008382.1-1597s1c1
Sequence:CCGGCCCGAGAAAGAAGTTCCTCAACTCGAGTTGAGGAACTTCTTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-1093s1c1
Sequence:CCGGCCTTCCATTCTGCCGTCTTTACTCGAGTAAAGACGGCAGAATGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-768s1c1
Sequence:CCGGGTCGTGAAACTCCAACTGGAACTCGAGTTCCAGTTGGAGTTTCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-1188s1c1
Sequence:CCGGCTCCTCTACCTTGACCATAATCTCGAGATTATGGTCAAGGTAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-480s1c1
Sequence:CCGGCGAGAGAAAGTCATCAGCTTTCTCGAGAAAGCTGATGACTTTCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008382.2-1643s21c1
Sequence:CCGGAGTAGAAGGGTGGGCAGATTACTCGAGTAATCTGCCCACCCTTCTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008382.2-872s21c1
Sequence:CCGGACGTCCCTTCTTGGAACTTAACTCGAGTTAAGTTCCAAGAAGGGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008382.2-396s21c1
Sequence:CCGGCTAACCAGCCGTCCCAGAATACTCGAGTATTCTGGGACGGCTGGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008382
INHBE MISSION shRNA Lentiviral Transduction Particles
inhibin, beta E
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008382.1-1597s1c1
Sequence:CCGGCCCGAGAAAGAAGTTCCTCAACTCGAGTTGAGGAACTTCTTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-1093s1c1
Sequence:CCGGCCTTCCATTCTGCCGTCTTTACTCGAGTAAAGACGGCAGAATGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-768s1c1
Sequence:CCGGGTCGTGAAACTCCAACTGGAACTCGAGTTCCAGTTGGAGTTTCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-1188s1c1
Sequence:CCGGCTCCTCTACCTTGACCATAATCTCGAGATTATGGTCAAGGTAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008382.1-480s1c1
Sequence:CCGGCGAGAGAAAGTCATCAGCTTTCTCGAGAAAGCTGATGACTTTCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008382.2-1643s21c1
Sequence:CCGGAGTAGAAGGGTGGGCAGATTACTCGAGTAATCTGCCCACCCTTCTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008382.2-872s21c1
Sequence:CCGGACGTCCCTTCTTGGAACTTAACTCGAGTTAAGTTCCAAGAAGGGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008382.2-396s21c1
Sequence:CCGGCTAACCAGCCGTCCCAGAATACTCGAGTATTCTGGGACGGCTGGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031479
INHBE MISSION shRNA Bacterial Glycerol Stock
inhibin, beta E
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-971s1c1
Sequence:CCGGGCGAGACCATTACGTAGACTTCTCGAGAAGTCTACGTAATGGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-1205s1c1
Sequence:CCGGCCTGGATCATAATGGCAATGTCTCGAGACATTGCCATTATGATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-402s1c1
Sequence:CCGGCGTCCCAGAATAACTCATCCTCTCGAGAGGATGAGTTATTCTGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-1197s1c1
Sequence:CCGGCTCCTCTACCTGGATCATAATCTCGAGATTATGATCCAGGTAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-619s1c1
Sequence:CCGGCCACCCTTCCTGGCACTCTTTCTCGAGAAAGAGTGCCAGGAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031479.3-869s21c1
Sequence:CCGGGCAGCCCTTCCTAGAGCTTAACTCGAGTTAAGCTCTAGGAAGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031479.3-718s21c1
Sequence:CCGGACCTGGGCTGGCATACCTTAACTCGAGTTAAGGTATGCCAGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031479
INHBE MISSION shRNA shRNA Plasmid DNA
inhibin, beta E
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-971s1c1
Sequence:CCGGGCGAGACCATTACGTAGACTTCTCGAGAAGTCTACGTAATGGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-1205s1c1
Sequence:CCGGCCTGGATCATAATGGCAATGTCTCGAGACATTGCCATTATGATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-402s1c1
Sequence:CCGGCGTCCCAGAATAACTCATCCTCTCGAGAGGATGAGTTATTCTGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-1197s1c1
Sequence:CCGGCTCCTCTACCTGGATCATAATCTCGAGATTATGATCCAGGTAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-619s1c1
Sequence:CCGGCCACCCTTCCTGGCACTCTTTCTCGAGAAAGAGTGCCAGGAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031479.3-869s21c1
Sequence:CCGGGCAGCCCTTCCTAGAGCTTAACTCGAGTTAAGCTCTAGGAAGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031479.3-718s21c1
Sequence:CCGGACCTGGGCTGGCATACCTTAACTCGAGTTAAGGTATGCCAGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031479
INHBE MISSION shRNA Lentiviral Transduction Particles
inhibin, beta E
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-971s1c1
Sequence:CCGGGCGAGACCATTACGTAGACTTCTCGAGAAGTCTACGTAATGGTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-1205s1c1
Sequence:CCGGCCTGGATCATAATGGCAATGTCTCGAGACATTGCCATTATGATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-402s1c1
Sequence:CCGGCGTCCCAGAATAACTCATCCTCTCGAGAGGATGAGTTATTCTGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-1197s1c1
Sequence:CCGGCTCCTCTACCTGGATCATAATCTCGAGATTATGATCCAGGTAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031479.3-619s1c1
Sequence:CCGGCCACCCTTCCTGGCACTCTTTCTCGAGAAAGAGTGCCAGGAAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031479.3-869s21c1
Sequence:CCGGGCAGCCCTTCCTAGAGCTTAACTCGAGTTAAGCTCTAGGAAGGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031479.3-718s21c1
Sequence:CCGGACCTGGGCTGGCATACCTTAACTCGAGTTAAGGTATGCCAGCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)