EMAIL THIS PAGE TO A FRIEND

INIP

INTS3 and NABP interacting protein

59 Gene Product Result for
Synonyms: C9orf80 HSPC043 MISE SOSSC SSBIP1 hSSBIP1
UniProtKB ID: Q9NRY2, Q5VWJ7, Q96E04, Q9P090
Gene ID:
Human(58493) Summary: SOSSC is a subunit of single-stranded DNA (ssDNA)-binding complexes involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501]
Mouse(66209) INTS3 and NABP interacting protein
Rat(298032) INTS3 and NABP interacting protein
sheep(101110478) INTS3 and NABP interacting protein
domestic guinea pig(100717522) INTS3 and NABP interacting protein
naked mole-rat(101698481) INTS3 and NABP interacting protein
Zebrafish(393188) ints3 and nabp interacting protein
dog(481671) INTS3 and NABP interacting protein
cow(616784) chromosome 8 open reading frame, human C9orf80
domestic cat(101080333) INTS3 and NABP interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA020382 Anti-INIP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021218 Rosetta Predictions human pricing
XM_001061972 Rosetta Predictions rat pricing
XM_216387 Rosetta Predictions rat pricing
NM_001013577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078402 predicted 401
2 SASI_Hs02_00354830 predicted 963
3 SASI_Hs01_00078404 predicted 907
4 SASI_Hs01_00078406 predicted 409
5 SASI_Hs01_00078407 predicted 293
6 SASI_Hs01_00078408 predicted 390
7 SASI_Hs01_00078409 predicted 310
8 SASI_Hs02_00354831 predicted 976
9 SASI_Hs01_00078410 predicted 359
10 SASI_Hs01_00078411 predicted 952
11 SASI_Hs01_00078403 predicted 268
12 SASI_Hs01_00078405 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301955 predicted 1146
2 SASI_Rn02_00301956 predicted 275
3 SASI_Rn02_00301957 predicted 273
4 SASI_Rn02_00301958 predicted 1038
5 SASI_Rn02_00301959 predicted 731
6 SASI_Rn02_00301960 predicted 560
7 SASI_Rn02_00301961 predicted 748
8 SASI_Rn02_00301962 predicted 1187
9 SASI_Rn02_00301963 predicted 800
10 SASI_Rn02_00301964 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376560 predicted 277
2 SASI_Rn02_00376561 predicted 682
3 SASI_Rn02_00376562 predicted 943
4 SASI_Rn02_00376563 predicted 730
5 SASI_Rn02_00376564 predicted 555
6 SASI_Rn02_00376565 predicted 800
7 SASI_Rn02_00376566 predicted 467
8 SASI_Rn02_00376567 predicted 982
9 SASI_Rn02_00376568 predicted 765
10 SASI_Rn02_00376569 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287232 predicted 449
2 SASI_Mm02_00287233 predicted 612
3 SASI_Mm02_00287234 predicted 265
4 SASI_Mm02_00287235 predicted 991
5 SASI_Mm02_00287236 predicted 563
6 SASI_Mm02_00287237 predicted 411
7 SASI_Mm02_00287238 predicted 770
8 SASI_Mm02_00287239 predicted 241
9 SASI_Mm02_00287240 predicted 993
10 SASI_Mm02_00287241 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021218
VALIDATED
INIP MISSION shRNA Bacterial Glycerol Stock
INTS3 and NABP interacting protein
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-681s21c1
Sequence:CCGGGTATCGTCCAAGGAATTGATTCTCGAGAATCAATTCCTTGGACGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-557s21c1
Sequence:CCGGGCTACATGAACTGTGACTTTACTCGAGTAAAGTCACAGTTCATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021218.1-438s21c1
Sequence:CCGGCTCTGCATTTGGGAACCTTATCTCGAGATAAGGTTCCCAAATGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-731s21c1
Sequence:CCGGGCTGTTTAACTCTCAATCAGACTCGAGTCTGATTGAGAGTTAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-363s1c1
Sequence:CCGGGCATATTGCAGCCCAACAGAACTCGAGTTCTGTTGGGCTGCAATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-235s1c1
Sequence:CCGGGCAGAACTGGACAAAGAGAAACTCGAGTTTCTCTTTGTCCAGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-1050s1c1
Sequence:CCGGCTAACCAGTCTTAACCATCTTCTCGAGAAGATGGTTAAGACTGGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021218.1-431s1c1
Sequence:CCGGCTCAAGACTCTGCATTTGGGACTCGAGTCCCAAATGCAGAGTCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-328s1c1
Sequence:CCGGCTTAATAAGGACTTCCGGGATCTCGAGATCCCGGAAGTCCTTATTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-270s1c1
Sequence:CCGGGCAGAACCAGTCTTCAACAAACTCGAGTTTGTTGAAGACTGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-438s1c1
Sequence:CCGGCTCTGCATTTGGGAACCTTATCTCGAGATAAGGTTCCCAAATGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021218.1-273s1c1
Sequence:CCGGGAACCAGTCTTCAACAAATCACTCGAGTGATTTGTTGAAGACTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-731s1c1
Sequence:CCGGGCTGTTTAACTCTCAATCAGACTCGAGTCTGATTGAGAGTTAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-681s1c1
Sequence:CCGGGTATCGTCCAAGGAATTGATTCTCGAGAATCAATTCCTTGGACGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-557s1c1
Sequence:CCGGGCTACATGAACTGTGACTTTACTCGAGTAAAGTCACAGTTCATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021218
VALIDATED
INIP MISSION shRNA shRNA Plasmid DNA
INTS3 and NABP interacting protein
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-681s21c1
Sequence:CCGGGTATCGTCCAAGGAATTGATTCTCGAGAATCAATTCCTTGGACGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-557s21c1
Sequence:CCGGGCTACATGAACTGTGACTTTACTCGAGTAAAGTCACAGTTCATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021218.1-438s21c1
Sequence:CCGGCTCTGCATTTGGGAACCTTATCTCGAGATAAGGTTCCCAAATGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-731s21c1
Sequence:CCGGGCTGTTTAACTCTCAATCAGACTCGAGTCTGATTGAGAGTTAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-363s1c1
Sequence:CCGGGCATATTGCAGCCCAACAGAACTCGAGTTCTGTTGGGCTGCAATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-235s1c1
Sequence:CCGGGCAGAACTGGACAAAGAGAAACTCGAGTTTCTCTTTGTCCAGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-1050s1c1
Sequence:CCGGCTAACCAGTCTTAACCATCTTCTCGAGAAGATGGTTAAGACTGGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021218.1-431s1c1
Sequence:CCGGCTCAAGACTCTGCATTTGGGACTCGAGTCCCAAATGCAGAGTCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-328s1c1
Sequence:CCGGCTTAATAAGGACTTCCGGGATCTCGAGATCCCGGAAGTCCTTATTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-270s1c1
Sequence:CCGGGCAGAACCAGTCTTCAACAAACTCGAGTTTGTTGAAGACTGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-438s1c1
Sequence:CCGGCTCTGCATTTGGGAACCTTATCTCGAGATAAGGTTCCCAAATGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021218.1-273s1c1
Sequence:CCGGGAACCAGTCTTCAACAAATCACTCGAGTGATTTGTTGAAGACTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-731s1c1
Sequence:CCGGGCTGTTTAACTCTCAATCAGACTCGAGTCTGATTGAGAGTTAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-681s1c1
Sequence:CCGGGTATCGTCCAAGGAATTGATTCTCGAGAATCAATTCCTTGGACGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-557s1c1
Sequence:CCGGGCTACATGAACTGTGACTTTACTCGAGTAAAGTCACAGTTCATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021218
VALIDATED
INIP MISSION shRNA Lentiviral Transduction Particles
INTS3 and NABP interacting protein
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-681s21c1
Sequence:CCGGGTATCGTCCAAGGAATTGATTCTCGAGAATCAATTCCTTGGACGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-557s21c1
Sequence:CCGGGCTACATGAACTGTGACTTTACTCGAGTAAAGTCACAGTTCATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021218.1-438s21c1
Sequence:CCGGCTCTGCATTTGGGAACCTTATCTCGAGATAAGGTTCCCAAATGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021218.1-731s21c1
Sequence:CCGGGCTGTTTAACTCTCAATCAGACTCGAGTCTGATTGAGAGTTAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-363s1c1
Sequence:CCGGGCATATTGCAGCCCAACAGAACTCGAGTTCTGTTGGGCTGCAATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-235s1c1
Sequence:CCGGGCAGAACTGGACAAAGAGAAACTCGAGTTTCTCTTTGTCCAGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-1050s1c1
Sequence:CCGGCTAACCAGTCTTAACCATCTTCTCGAGAAGATGGTTAAGACTGGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021218.1-431s1c1
Sequence:CCGGCTCAAGACTCTGCATTTGGGACTCGAGTCCCAAATGCAGAGTCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-328s1c1
Sequence:CCGGCTTAATAAGGACTTCCGGGATCTCGAGATCCCGGAAGTCCTTATTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-270s1c1
Sequence:CCGGGCAGAACCAGTCTTCAACAAACTCGAGTTTGTTGAAGACTGGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-438s1c1
Sequence:CCGGCTCTGCATTTGGGAACCTTATCTCGAGATAAGGTTCCCAAATGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021218.1-273s1c1
Sequence:CCGGGAACCAGTCTTCAACAAATCACTCGAGTGATTTGTTGAAGACTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-731s1c1
Sequence:CCGGGCTGTTTAACTCTCAATCAGACTCGAGTCTGATTGAGAGTTAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-681s1c1
Sequence:CCGGGTATCGTCCAAGGAATTGATTCTCGAGAATCAATTCCTTGGACGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021218.1-557s1c1
Sequence:CCGGGCTACATGAACTGTGACTTTACTCGAGTAAAGTCACAGTTCATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013577
INIP MISSION shRNA Bacterial Glycerol Stock
INTS3 and NABP interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013577.1-1503s21c1
Sequence:CCGGGGCTTAGGGAGTCCTATAATACTCGAGTATTATAGGACTCCCTAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013577.1-433s1c1
Sequence:CCGGCATAACTCAAGACTCTGCCTTCTCGAGAAGGCAGAGTCTTGAGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013577.1-284s1c1
Sequence:CCGGCAATCTTCAACAAGCCACCCTCTCGAGAGGGTGGCTTGTTGAAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013577.1-2317s1c1
Sequence:CCGGGAGCGTCTACCTCAGTTAATACTCGAGTATTAACTGAGGTAGACGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-323s21c1
Sequence:CCGGTCCAGACCCTCTCTTACCAAGCTCGAGCTTGGTAAGAGAGGGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-271s21c1
Sequence:CCGGACTTATGCAGAACCAATCTTCCTCGAGGAAGATTGGTTCTGCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-417s21c1
Sequence:CCGGATTCCTCTGGCTACTTCATAACTCGAGTTATGAAGTAGCCAGAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-447s21c1
Sequence:CCGGCTGCCTTTGGGAATCTGATTCCTCGAGGAATCAGATTCCCAAAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013577
INIP MISSION shRNA shRNA Plasmid DNA
INTS3 and NABP interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013577.1-1503s21c1
Sequence:CCGGGGCTTAGGGAGTCCTATAATACTCGAGTATTATAGGACTCCCTAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013577.1-433s1c1
Sequence:CCGGCATAACTCAAGACTCTGCCTTCTCGAGAAGGCAGAGTCTTGAGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013577.1-284s1c1
Sequence:CCGGCAATCTTCAACAAGCCACCCTCTCGAGAGGGTGGCTTGTTGAAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013577.1-2317s1c1
Sequence:CCGGGAGCGTCTACCTCAGTTAATACTCGAGTATTAACTGAGGTAGACGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-323s21c1
Sequence:CCGGTCCAGACCCTCTCTTACCAAGCTCGAGCTTGGTAAGAGAGGGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-271s21c1
Sequence:CCGGACTTATGCAGAACCAATCTTCCTCGAGGAAGATTGGTTCTGCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-417s21c1
Sequence:CCGGATTCCTCTGGCTACTTCATAACTCGAGTTATGAAGTAGCCAGAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-447s21c1
Sequence:CCGGCTGCCTTTGGGAATCTGATTCCTCGAGGAATCAGATTCCCAAAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013577
INIP MISSION shRNA Lentiviral Transduction Particles
INTS3 and NABP interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013577.1-1503s21c1
Sequence:CCGGGGCTTAGGGAGTCCTATAATACTCGAGTATTATAGGACTCCCTAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013577.1-433s1c1
Sequence:CCGGCATAACTCAAGACTCTGCCTTCTCGAGAAGGCAGAGTCTTGAGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013577.1-284s1c1
Sequence:CCGGCAATCTTCAACAAGCCACCCTCTCGAGAGGGTGGCTTGTTGAAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013577.1-2317s1c1
Sequence:CCGGGAGCGTCTACCTCAGTTAATACTCGAGTATTAACTGAGGTAGACGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-323s21c1
Sequence:CCGGTCCAGACCCTCTCTTACCAAGCTCGAGCTTGGTAAGAGAGGGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-271s21c1
Sequence:CCGGACTTATGCAGAACCAATCTTCCTCGAGGAAGATTGGTTCTGCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-417s21c1
Sequence:CCGGATTCCTCTGGCTACTTCATAACTCGAGTTATGAAGTAGCCAGAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013577.1-447s21c1
Sequence:CCGGCTGCCTTTGGGAATCTGATTCCTCGAGGAATCAGATTCCCAAAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)