EMAIL THIS PAGE TO A FRIEND

INMT

indolethylamine N-methyltransferase

65 Gene Product Result for
Synonyms: TEMT
UniProtKB ID: O95050, B8ZZ69, Q3KP49, Q9P1Y2, Q9UBY4, Q9UHQ0
Gene ID:
Human(11185) Summary: N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream FAM188B (family with sequence similarity 188, member B) gene. [provided by RefSeq, Nov 2010]
Mouse(21743) indolethylamine N-methyltransferase
Rat(368066) indolethylamine N-methyltransferase
Domestic Rabbit(100008695) indolethylamine N-methyltransferase
domestic guinea pig(100724009) indolethylamine N-methyltransferase
dog(489397) indolethylamine N-methyltransferase
cow(527922) indolethylamine N-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006774 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006774 Rosetta Predictions human pricing
NM_001109022 Rosetta Predictions rat pricing
NM_009349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189198 predicted 890
2 SASI_Hs01_00189199 predicted 725
3 SASI_Hs01_00189200 predicted 245
4 SASI_Hs01_00189202 predicted 878
5 SASI_Hs01_00189203 predicted 933
6 SASI_Hs01_00189204 predicted 964
7 SASI_Hs01_00189205 predicted 335
8 SASI_Hs01_00189206 predicted 203
9 SASI_Hs01_00189207 predicted 232
10 SASI_Hs02_00342281 predicted 688
11 SASI_Hs01_00189201 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244404 predicted 215
2 SASI_Rn02_00244405 predicted 788
3 SASI_Rn02_00244406 predicted 286
4 SASI_Rn02_00244407 predicted 631
5 SASI_Rn02_00244408 predicted 363
6 SASI_Rn02_00244409 predicted 566
7 SASI_Rn02_00244410 predicted 458
8 SASI_Rn02_00244411 predicted 449
9 SASI_Rn02_00244412 predicted 460
10 SASI_Rn02_00244413 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089767 predicted 321
2 SASI_Mm01_00089768 predicted 345
3 SASI_Mm02_00315930 predicted 228
4 SASI_Mm01_00089771 predicted 227
5 SASI_Mm01_00089772 predicted 415
6 SASI_Mm01_00089773 predicted 218
7 SASI_Mm01_00089774 predicted 720
8 SASI_Mm01_00089776 predicted 317
9 SASI_Mm02_00315931 predicted 409
10 SASI_Mm02_00315932 predicted 463
11 SASI_Mm01_00089769 predicted 513
12 SASI_Mm01_00089770 predicted 698
13 SASI_Mm01_00089775 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009349
INMT MISSION shRNA Bacterial Glycerol Stock
indolethylamine N-methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009349.1-827s1c1
Sequence:CCGGCCCTGGGAAAGTTATAGCAATCTCGAGATTGCTATAACTTTCCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-334s1c1
Sequence:CCGGCCTCCATAGTGCAACATGCATCTCGAGATGCATGTTGCACTATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-518s1c1
Sequence:CCGGCTGCCCTGATATAGATACCTACTCGAGTAGGTATCTATATCAGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-110s1c1
Sequence:CCGGAGAGCAGGAAATCGTAAAGTTCTCGAGAACTTTACGATTTCCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-111s1c1
Sequence:CCGGGAGCAGGAAATCGTAAAGTTTCTCGAGAAACTTTACGATTTCCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009349
INMT MISSION shRNA shRNA Plasmid DNA
indolethylamine N-methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009349.1-827s1c1
Sequence:CCGGCCCTGGGAAAGTTATAGCAATCTCGAGATTGCTATAACTTTCCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-334s1c1
Sequence:CCGGCCTCCATAGTGCAACATGCATCTCGAGATGCATGTTGCACTATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-518s1c1
Sequence:CCGGCTGCCCTGATATAGATACCTACTCGAGTAGGTATCTATATCAGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-110s1c1
Sequence:CCGGAGAGCAGGAAATCGTAAAGTTCTCGAGAACTTTACGATTTCCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-111s1c1
Sequence:CCGGGAGCAGGAAATCGTAAAGTTTCTCGAGAAACTTTACGATTTCCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009349
INMT MISSION shRNA Lentiviral Transduction Particles
indolethylamine N-methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009349.1-827s1c1
Sequence:CCGGCCCTGGGAAAGTTATAGCAATCTCGAGATTGCTATAACTTTCCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-334s1c1
Sequence:CCGGCCTCCATAGTGCAACATGCATCTCGAGATGCATGTTGCACTATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-518s1c1
Sequence:CCGGCTGCCCTGATATAGATACCTACTCGAGTAGGTATCTATATCAGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-110s1c1
Sequence:CCGGAGAGCAGGAAATCGTAAAGTTCTCGAGAACTTTACGATTTCCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009349.1-111s1c1
Sequence:CCGGGAGCAGGAAATCGTAAAGTTTCTCGAGAAACTTTACGATTTCCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006774
INMT MISSION shRNA Bacterial Glycerol Stock
indolethylamine N-methyltransferase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-80s1c1
Sequence:CCGGGCTACTTACTACAGCTTCGATCTCGAGATCGAAGCTGTAGTAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-734s1c1
Sequence:CCGGCAGAGCTACTCTGTCACCAATCTCGAGATTGGTGACAGAGTAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-126s1c1
Sequence:CCGGTGCTGAAGTTTAACTTGGAATCTCGAGATTCCAAGTTAAACTTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-686s1c1
Sequence:CCGGGCTGTCCTGGATGCTGGCTTTCTCGAGAAAGCCAGCATCCAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006774.4-183s21c1
Sequence:CCGGGGGACACGCTGATTGACATTGCTCGAGCAATGTCAATCAGCGTGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006774.4-1137s21c1
Sequence:CCGGTGAGTCTACCTAATATGTTAACTCGAGTTAACATATTAGGTAGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006774.4-1101s21c1
Sequence:CCGGAGAGTCTACCTAATATGTTAACTCGAGTTAACATATTAGGTAGACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006774
INMT MISSION shRNA shRNA Plasmid DNA
indolethylamine N-methyltransferase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-80s1c1
Sequence:CCGGGCTACTTACTACAGCTTCGATCTCGAGATCGAAGCTGTAGTAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-734s1c1
Sequence:CCGGCAGAGCTACTCTGTCACCAATCTCGAGATTGGTGACAGAGTAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-126s1c1
Sequence:CCGGTGCTGAAGTTTAACTTGGAATCTCGAGATTCCAAGTTAAACTTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-686s1c1
Sequence:CCGGGCTGTCCTGGATGCTGGCTTTCTCGAGAAAGCCAGCATCCAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006774.4-183s21c1
Sequence:CCGGGGGACACGCTGATTGACATTGCTCGAGCAATGTCAATCAGCGTGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006774.4-1137s21c1
Sequence:CCGGTGAGTCTACCTAATATGTTAACTCGAGTTAACATATTAGGTAGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006774.4-1101s21c1
Sequence:CCGGAGAGTCTACCTAATATGTTAACTCGAGTTAACATATTAGGTAGACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006774
INMT MISSION shRNA Lentiviral Transduction Particles
indolethylamine N-methyltransferase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-80s1c1
Sequence:CCGGGCTACTTACTACAGCTTCGATCTCGAGATCGAAGCTGTAGTAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-734s1c1
Sequence:CCGGCAGAGCTACTCTGTCACCAATCTCGAGATTGGTGACAGAGTAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-126s1c1
Sequence:CCGGTGCTGAAGTTTAACTTGGAATCTCGAGATTCCAAGTTAAACTTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006774.3-686s1c1
Sequence:CCGGGCTGTCCTGGATGCTGGCTTTCTCGAGAAAGCCAGCATCCAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006774.4-183s21c1
Sequence:CCGGGGGACACGCTGATTGACATTGCTCGAGCAATGTCAATCAGCGTGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006774.4-1137s21c1
Sequence:CCGGTGAGTCTACCTAATATGTTAACTCGAGTTAACATATTAGGTAGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006774.4-1101s21c1
Sequence:CCGGAGAGTCTACCTAATATGTTAACTCGAGTTAACATATTAGGTAGACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)