EMAIL THIS PAGE TO A FRIEND

INO80

INO80 complex subunit

162 Gene Product Result for
Synonyms: INO80A INOC1 hINO80
UniProtKB ID: Q9ULG1, A6H8X4, Q9NTG6
Gene ID:
Human(54617) Summary: The protein encoded by this gene represents the catalytic ATPase subunit of the INO80 chromatin remodeling complex. This complex binds DNA and is recruited by YY1 to activate certain genes.[provided by RefSeq, Apr 2010]
Mouse(68142) INO80 homolog (S. cerevisiae)
Rat(296084) INO80 homolog (S. cerevisiae)
Zebrafish(566768) INO80 homolog (S. cerevisiae)
cow(505992) INO80 homolog (S. cerevisiae)
Horse(100057033) INO80 homolog (S. cerevisiae)
domestic cat(101086727) INO80 homolog (S. cerevisiae)
dog(478262) INO80 homolog (S. cerevisiae)
chicken(423210) INO80 homolog (S. cerevisiae)
Thale Cress(824897) DNA helicase INO80 complex-like 1
fruit fly(42314) CG31212 gene product from transcript CG31212-RA
domestic guinea pig(100718793) INO80 homolog (S. cerevisiae)
naked mole-rat(101722270) INO80 homolog (S. cerevisiae)
sheep(101112063) INO80 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017553 Rosetta Predictions human pricing
XM_001080838 Rosetta Predictions rat pricing
XM_230473 Rosetta Predictions rat pricing
NM_026574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350195 predicted 1780
2 SASI_Hs01_00018035 predicted 2356
3 SASI_Hs02_00350196 predicted 4399
4 SASI_Hs02_00350197 predicted 2378
5 SASI_Hs01_00018036 predicted 1399
6 SASI_Hs01_00018037 predicted 2527
7 SASI_Hs01_00018038 predicted 2751
8 SASI_Hs02_00350198 predicted 499
9 SASI_Hs01_00018039 predicted 2140
10 SASI_Hs01_00018041 predicted 3985
11 SASI_Hs01_00018034 predicted 2479
12 SASI_Hs01_00018040 predicted 584
13 SASI_Hs01_00018042 predicted 1111
14 SASI_Hs01_00018043 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369599 predicted 1617
2 SASI_Rn02_00369600 predicted 2244
3 SASI_Rn02_00369601 predicted 1235
4 SASI_Rn02_00369602 predicted 2506
5 SASI_Rn02_00369603 predicted 1419
6 SASI_Rn02_00369604 predicted 1521
7 SASI_Rn02_00369605 predicted 1363
8 SASI_Rn02_00369606 predicted 4467
9 SASI_Rn02_00369607 predicted 2617
10 SASI_Rn02_00369608 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386256 predicted 327
2 SASI_Rn02_00386257 predicted 209
3 SASI_Rn02_00386258 predicted 368
4 SASI_Rn02_00386259 predicted 362
5 SASI_Rn02_00386260 predicted 229
6 SASI_Rn02_00386261 predicted 288
7 SASI_Rn02_00386262 predicted 287
8 SASI_Rn02_00386263 predicted 215
9 SASI_Rn02_00386264 predicted 265
10 SASI_Rn02_00386265 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056978 predicted 1193
2 SASI_Mm01_00056979 predicted 2492
3 SASI_Mm01_00056980 predicted 2613
4 SASI_Mm01_00056981 predicted 2751
5 SASI_Mm01_00056982 predicted 4078
6 SASI_Mm01_00056983 predicted 2594
7 SASI_Mm01_00056984 predicted 2227
8 SASI_Mm01_00056985 predicted 2860
9 SASI_Mm01_00056986 predicted 1618
10 SASI_Mm02_00330535 predicted 3985
11 SASI_Mm01_00056977 predicted 2661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017553
INO80 MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-1407s21c1
Sequence:CCGGCATGAGTCGCAAACGAGATATCTCGAGATATCTCGTTTGCGACTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017553.1-5320s21c1
Sequence:CCGGGCTAGTAAGGGAGATTGTATACTCGAGTATACAATCTCCCTTACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-2659s21c1
Sequence:CCGGTGTAATCACCCGGAGTTATTTCTCGAGAAATAACTCCGGGTGATTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-411s21c1
Sequence:CCGGGGATCCCTTAATACAAGTTAACTCGAGTTAACTTGTATTAAGGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-1806s21c1
Sequence:CCGGTCTATATGAACAGGGTATTAACTCGAGTTAATACCCTGTTCATATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-378s21c1
Sequence:CCGGGGATGACAGTAATCCATTATTCTCGAGAATAATGGATTACTGTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-2714s21c1
Sequence:CCGGCCCTAAAGCCATACCACATTTCTCGAGAAATGTGGTATGGCTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-4645s21c1
Sequence:CCGGTACGGGTACAACGTGTCTAAACTCGAGTTTAGACACGTTGTACCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017553
INO80 MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-1407s21c1
Sequence:CCGGCATGAGTCGCAAACGAGATATCTCGAGATATCTCGTTTGCGACTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017553.1-5320s21c1
Sequence:CCGGGCTAGTAAGGGAGATTGTATACTCGAGTATACAATCTCCCTTACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-2659s21c1
Sequence:CCGGTGTAATCACCCGGAGTTATTTCTCGAGAAATAACTCCGGGTGATTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-411s21c1
Sequence:CCGGGGATCCCTTAATACAAGTTAACTCGAGTTAACTTGTATTAAGGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-1806s21c1
Sequence:CCGGTCTATATGAACAGGGTATTAACTCGAGTTAATACCCTGTTCATATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-378s21c1
Sequence:CCGGGGATGACAGTAATCCATTATTCTCGAGAATAATGGATTACTGTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-2714s21c1
Sequence:CCGGCCCTAAAGCCATACCACATTTCTCGAGAAATGTGGTATGGCTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-4645s21c1
Sequence:CCGGTACGGGTACAACGTGTCTAAACTCGAGTTTAGACACGTTGTACCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017553
INO80 MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-1407s21c1
Sequence:CCGGCATGAGTCGCAAACGAGATATCTCGAGATATCTCGTTTGCGACTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017553.1-5320s21c1
Sequence:CCGGGCTAGTAAGGGAGATTGTATACTCGAGTATACAATCTCCCTTACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-2659s21c1
Sequence:CCGGTGTAATCACCCGGAGTTATTTCTCGAGAAATAACTCCGGGTGATTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-411s21c1
Sequence:CCGGGGATCCCTTAATACAAGTTAACTCGAGTTAACTTGTATTAAGGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-1806s21c1
Sequence:CCGGTCTATATGAACAGGGTATTAACTCGAGTTAATACCCTGTTCATATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-378s21c1
Sequence:CCGGGGATGACAGTAATCCATTATTCTCGAGAATAATGGATTACTGTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-2714s21c1
Sequence:CCGGCCCTAAAGCCATACCACATTTCTCGAGAAATGTGGTATGGCTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017553.1-4645s21c1
Sequence:CCGGTACGGGTACAACGTGTCTAAACTCGAGTTTAGACACGTTGTACCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032196
VALIDATED
INO80 MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032196.3-5474s1c1
Sequence:CCGGGCAGTTGTGTTCCCAGCAATTCTCGAGAATTGCTGGGAACACAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-1111s1c1
Sequence:CCGGCGTAACCTGTTTCTCACCAATCTCGAGATTGGTGAGAAACAGGTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-1186s1c1
Sequence:CCGGGCCCAGAAGAACTGTAAGGAACTCGAGTTCCTTACAGTTCTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032196.3-415s1c1
Sequence:CCGGCCCTTAATACAAGTTAAGGAACTCGAGTTCCTTAACTTGTATTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-2529s1c1
Sequence:CCGGGCTGCTATATCAGGCACTAAACTCGAGTTTAGTGCCTGATATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032196
VALIDATED
INO80 MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032196.3-5474s1c1
Sequence:CCGGGCAGTTGTGTTCCCAGCAATTCTCGAGAATTGCTGGGAACACAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-1111s1c1
Sequence:CCGGCGTAACCTGTTTCTCACCAATCTCGAGATTGGTGAGAAACAGGTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-1186s1c1
Sequence:CCGGGCCCAGAAGAACTGTAAGGAACTCGAGTTCCTTACAGTTCTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032196.3-415s1c1
Sequence:CCGGCCCTTAATACAAGTTAAGGAACTCGAGTTCCTTAACTTGTATTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-2529s1c1
Sequence:CCGGGCTGCTATATCAGGCACTAAACTCGAGTTTAGTGCCTGATATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032196
VALIDATED
INO80 MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032196.3-5474s1c1
Sequence:CCGGGCAGTTGTGTTCCCAGCAATTCTCGAGAATTGCTGGGAACACAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-1111s1c1
Sequence:CCGGCGTAACCTGTTTCTCACCAATCTCGAGATTGGTGAGAAACAGGTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-1186s1c1
Sequence:CCGGGCCCAGAAGAACTGTAAGGAACTCGAGTTCCTTACAGTTCTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032196.3-415s1c1
Sequence:CCGGCCCTTAATACAAGTTAAGGAACTCGAGTTCCTTAACTTGTATTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032196.3-2529s1c1
Sequence:CCGGGCTGCTATATCAGGCACTAAACTCGAGTTTAGTGCCTGATATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026574
VALIDATED
INO80 MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026574.2-5981s1c1
Sequence:CCGGCCTCTAATTTGCACACCTGAACTCGAGTTCAGGTGTGCAAATTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026574.2-871s1c1
Sequence:CCGGGCTCTCTACATACGACCCTTTCTCGAGAAAGGGTCGTATGTAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-3364s1c1
Sequence:CCGGGCCGTTGGATTCTTACTGTAACTCGAGTTACAGTAAGAATCCAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-2291s1c1
Sequence:CCGGCGTTGGAAGATTCTCTTACAACTCGAGTTGTAAGAGAATCTTCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-3553s1c1
Sequence:CCGGCGGCTGGTCTTTCATCAGAATCTCGAGATTCTGATGAAAGACCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026574
VALIDATED
INO80 MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026574.2-5981s1c1
Sequence:CCGGCCTCTAATTTGCACACCTGAACTCGAGTTCAGGTGTGCAAATTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026574.2-871s1c1
Sequence:CCGGGCTCTCTACATACGACCCTTTCTCGAGAAAGGGTCGTATGTAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-3364s1c1
Sequence:CCGGGCCGTTGGATTCTTACTGTAACTCGAGTTACAGTAAGAATCCAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-2291s1c1
Sequence:CCGGCGTTGGAAGATTCTCTTACAACTCGAGTTGTAAGAGAATCTTCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-3553s1c1
Sequence:CCGGCGGCTGGTCTTTCATCAGAATCTCGAGATTCTGATGAAAGACCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026574
VALIDATED
INO80 MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026574.2-5981s1c1
Sequence:CCGGCCTCTAATTTGCACACCTGAACTCGAGTTCAGGTGTGCAAATTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026574.2-871s1c1
Sequence:CCGGGCTCTCTACATACGACCCTTTCTCGAGAAAGGGTCGTATGTAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-3364s1c1
Sequence:CCGGGCCGTTGGATTCTTACTGTAACTCGAGTTACAGTAAGAATCCAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-2291s1c1
Sequence:CCGGCGTTGGAAGATTCTCTTACAACTCGAGTTGTAAGAGAATCTTCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026574.2-3553s1c1
Sequence:CCGGCGGCTGGTCTTTCATCAGAATCTCGAGATTCTGATGAAAGACCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)