EMAIL THIS PAGE TO A FRIEND

INO80B

INO80 complex subunit B

56 Gene Product Result for
Synonyms: HMGA1L4 HMGIYL4 IES2 PAP-1BP PAPA-1 ZNHIT4 hIes2
UniProtKB ID: Q9C086
Gene ID:
Human(83444) Summary: This gene encodes a subunit of an ATP-dependent chromatin remodeling complex, INO80, which plays a role in DNA and nucleosome-activated ATPase activity and ATP-dependent nucleosome sliding. Readthrough transcription of this gene into the neighboring downstream gene, which encodes WW domain-binding protein 1, generates a non-coding transcript. [provided by RefSeq, Feb 2011]
Mouse(70020) INO80 complex subunit B
Rat(500225) INO80 complex subunit B
sheep(101106673) INO80 complex subunit B
domestic guinea pig(100712918) INO80 complex subunit B
naked mole-rat(101700380) INO80 complex subunit B
chicken(429462) INO80 complex subunit B
dog(483105) INO80 complex subunit B
cow(509187) INO80 complex subunit B
domestic cat(101100634) INO80 complex subunit B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031288 Rosetta Predictions human pricing
NM_001048233 Rosetta Predictions rat pricing
NM_023547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072510 predicted 444
2 SASI_Hs01_00072511 predicted 230
3 SASI_Hs01_00072512 predicted 399
4 SASI_Hs01_00072513 predicted 285
5 SASI_Hs02_00358715 predicted 287
6 SASI_Hs02_00358716 predicted 402
7 SASI_Hs01_00072514 predicted 392
8 SASI_Hs02_00358717 predicted 303
9 SASI_Hs01_00072515 predicted 240
10 SASI_Hs01_00072516 predicted 341
11 SASI_Hs01_00072517 predicted 406
12 SASI_Hs01_00072518 predicted 412
13 SASI_Hs01_00072519 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207422 predicted 523
2 SASI_Rn02_00207423 predicted 523
3 SASI_Rn02_00207424 predicted 493
4 SASI_Rn02_00207425 predicted 713
5 SASI_Rn02_00207426 predicted 709
6 SASI_Rn02_00207427 predicted 435
7 SASI_Rn02_00207428 predicted 358
8 SASI_Rn02_00207429 predicted 561
9 SASI_Rn02_00207430 predicted 697
10 SASI_Rn02_00207431 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070573 predicted 317
2 SASI_Mm01_00070574 predicted 314
3 SASI_Mm01_00070575 predicted 310
4 SASI_Mm01_00070576 predicted 472
5 SASI_Mm01_00070577 predicted 452
6 SASI_Mm01_00070578 predicted 313
7 SASI_Mm01_00070579 predicted 326
8 SASI_Mm01_00070581 predicted 313
9 SASI_Mm02_00327185 predicted 414
10 SASI_Mm02_00327186 predicted 452
11 SASI_Mm01_00070580 predicted 399
12 SASI_Mm01_00070582 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031288
VALIDATED
INO80B MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-744s21c1
Sequence:CCGGGCACAAGAACCAGACTATCGACTCGAGTCGATAGTCTGGTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-243s1c1
Sequence:CCGGCCAAGAGTGTTCCTACCTTCACTCGAGTGAAGGTAGGAACACTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-298s1c1
Sequence:CCGGCCTTATGGTTGTGGATAATGACTCGAGTCATTATCCACAACCATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-368s1c1
Sequence:CCGGGATGAAGACAGTAATCTCTCTCTCGAGAGAGAGATTACTGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-294s21c1
Sequence:CCGGGAGTGTTCCTACCTTCACTGTCTCGAGACAGTGAAGGTAGGAACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-247s1c1
Sequence:CCGGGAGTGTTCCTACCTTCACTGTCTCGAGACAGTGAAGGTAGGAACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-121s1c1
Sequence:CCGGGAAGCACAAGAAGAAACACAACTCGAGTTGTGTTTCTTCTTGTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-133s1c1
Sequence:CCGGGAAACACAAGAAGAAACACCACTCGAGTGGTGTTTCTTCTTGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-311s1c1
Sequence:CCGGGATAATGAAGAGGAACCTATGCTCGAGCATAGGTTCCTCTTCATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-124s1c1
Sequence:CCGGGCACAAGAAGAAACACAAGAACTCGAGTTCTTGTGTTTCTTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-116s1c1
Sequence:CCGGCACAAGAAGCACAAGAAGAAACTCGAGTTTCTTCTTGTGCTTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-697s1c1
Sequence:CCGGGCACAAGAACCAGACTATCGACTCGAGTCGATAGTCTGGTTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-358s21c1
Sequence:CCGGGATAATGAAGAGGAACCTATGCTCGAGCATAGGTTCCTCTTCATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-415s21c1
Sequence:CCGGGATGAAGACAGTAATCTCTCTCTCGAGAGAGAGATTACTGTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031288
VALIDATED
INO80B MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-744s21c1
Sequence:CCGGGCACAAGAACCAGACTATCGACTCGAGTCGATAGTCTGGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-243s1c1
Sequence:CCGGCCAAGAGTGTTCCTACCTTCACTCGAGTGAAGGTAGGAACACTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-298s1c1
Sequence:CCGGCCTTATGGTTGTGGATAATGACTCGAGTCATTATCCACAACCATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-368s1c1
Sequence:CCGGGATGAAGACAGTAATCTCTCTCTCGAGAGAGAGATTACTGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-294s21c1
Sequence:CCGGGAGTGTTCCTACCTTCACTGTCTCGAGACAGTGAAGGTAGGAACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-247s1c1
Sequence:CCGGGAGTGTTCCTACCTTCACTGTCTCGAGACAGTGAAGGTAGGAACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-121s1c1
Sequence:CCGGGAAGCACAAGAAGAAACACAACTCGAGTTGTGTTTCTTCTTGTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-133s1c1
Sequence:CCGGGAAACACAAGAAGAAACACCACTCGAGTGGTGTTTCTTCTTGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-311s1c1
Sequence:CCGGGATAATGAAGAGGAACCTATGCTCGAGCATAGGTTCCTCTTCATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-124s1c1
Sequence:CCGGGCACAAGAAGAAACACAAGAACTCGAGTTCTTGTGTTTCTTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-116s1c1
Sequence:CCGGCACAAGAAGCACAAGAAGAAACTCGAGTTTCTTCTTGTGCTTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-697s1c1
Sequence:CCGGGCACAAGAACCAGACTATCGACTCGAGTCGATAGTCTGGTTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-358s21c1
Sequence:CCGGGATAATGAAGAGGAACCTATGCTCGAGCATAGGTTCCTCTTCATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-415s21c1
Sequence:CCGGGATGAAGACAGTAATCTCTCTCTCGAGAGAGAGATTACTGTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031288
VALIDATED
INO80B MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-744s21c1
Sequence:CCGGGCACAAGAACCAGACTATCGACTCGAGTCGATAGTCTGGTTCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-243s1c1
Sequence:CCGGCCAAGAGTGTTCCTACCTTCACTCGAGTGAAGGTAGGAACACTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-298s1c1
Sequence:CCGGCCTTATGGTTGTGGATAATGACTCGAGTCATTATCCACAACCATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-368s1c1
Sequence:CCGGGATGAAGACAGTAATCTCTCTCTCGAGAGAGAGATTACTGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-294s21c1
Sequence:CCGGGAGTGTTCCTACCTTCACTGTCTCGAGACAGTGAAGGTAGGAACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-247s1c1
Sequence:CCGGGAGTGTTCCTACCTTCACTGTCTCGAGACAGTGAAGGTAGGAACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-121s1c1
Sequence:CCGGGAAGCACAAGAAGAAACACAACTCGAGTTGTGTTTCTTCTTGTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-133s1c1
Sequence:CCGGGAAACACAAGAAGAAACACCACTCGAGTGGTGTTTCTTCTTGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-311s1c1
Sequence:CCGGGATAATGAAGAGGAACCTATGCTCGAGCATAGGTTCCTCTTCATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-124s1c1
Sequence:CCGGGCACAAGAAGAAACACAAGAACTCGAGTTCTTGTGTTTCTTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031288.1-116s1c1
Sequence:CCGGCACAAGAAGCACAAGAAGAAACTCGAGTTTCTTCTTGTGCTTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_031288.1-697s1c1
Sequence:CCGGGCACAAGAACCAGACTATCGACTCGAGTCGATAGTCTGGTTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-358s21c1
Sequence:CCGGGATAATGAAGAGGAACCTATGCTCGAGCATAGGTTCCTCTTCATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031288.2-415s21c1
Sequence:CCGGGATGAAGACAGTAATCTCTCTCTCGAGAGAGAGATTACTGTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023547
INO80B MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-268s1c1
Sequence:CCGGGTGGTGGATAATGAAGAGGAACTCGAGTTCCTCTTCATTATCCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-54s1c1
Sequence:CCGGCGGCCACGGAGTACACAAGAACTCGAGTTCTTGTGTACTCCGTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-480s1c1
Sequence:CCGGGCGGCTGCTTACAGCGAGACACTCGAGTGTCTCGCTGTAAGCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-327s1c1
Sequence:CCGGGCTGGATGAAGACAGTAATCTCTCGAGAGATTACTGTCTTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-217s1c1
Sequence:CCGGCCCACTTTCACTGTGATTCCTCTCGAGAGGAATCACAGTGAAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023547
INO80B MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-268s1c1
Sequence:CCGGGTGGTGGATAATGAAGAGGAACTCGAGTTCCTCTTCATTATCCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-54s1c1
Sequence:CCGGCGGCCACGGAGTACACAAGAACTCGAGTTCTTGTGTACTCCGTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-480s1c1
Sequence:CCGGGCGGCTGCTTACAGCGAGACACTCGAGTGTCTCGCTGTAAGCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-327s1c1
Sequence:CCGGGCTGGATGAAGACAGTAATCTCTCGAGAGATTACTGTCTTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-217s1c1
Sequence:CCGGCCCACTTTCACTGTGATTCCTCTCGAGAGGAATCACAGTGAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023547
INO80B MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-268s1c1
Sequence:CCGGGTGGTGGATAATGAAGAGGAACTCGAGTTCCTCTTCATTATCCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-54s1c1
Sequence:CCGGCGGCCACGGAGTACACAAGAACTCGAGTTCTTGTGTACTCCGTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-480s1c1
Sequence:CCGGGCGGCTGCTTACAGCGAGACACTCGAGTGTCTCGCTGTAAGCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-327s1c1
Sequence:CCGGGCTGGATGAAGACAGTAATCTCTCGAGAGATTACTGTCTTCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023547.1-217s1c1
Sequence:CCGGCCCACTTTCACTGTGATTCCTCTCGAGAGGAATCACAGTGAAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)