EMAIL THIS PAGE TO A FRIEND

INO80E

INO80 complex subunit E

106 Gene Product Result for
Synonyms: CCDC95
UniProtKB ID: Q8NBZ0
Gene ID:
Mouse(233875) INO80 complex subunit E
Rat(293494) INO80 complex subunit E
Zebrafish(402932) INO80 complex subunit E
dog(489944) INO80 complex subunit E
domestic cat(101100019) INO80 complex subunit E
cow(614852) INO80 complex subunit E
domestic guinea pig(100731509) INO80 complex subunit E
naked mole-rat(101706063) INO80 complex subunit E
sheep(101117296) INO80 complex subunit E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173618 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173618 Rosetta Predictions human pricing
NM_001013900 Rosetta Predictions rat pricing
NM_153580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107063 predicted 419
2 SASI_Hs01_00107064 predicted 342
3 SASI_Hs01_00107065 predicted 347
4 SASI_Hs01_00107066 predicted 937
5 SASI_Hs01_00107067 predicted 932
6 SASI_Hs01_00107068 predicted 943
7 SASI_Hs01_00107069 predicted 939
8 SASI_Hs01_00107062 predicted 946
9 SASI_Hs01_00107070 predicted 935
10 SASI_Hs01_00107071 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044658 predicted 730
2 SASI_Rn01_00044659 predicted 308
3 SASI_Rn02_00201181 predicted 911
4 SASI_Rn01_00044660 predicted 881
5 SASI_Rn01_00044661 predicted 1173
6 SASI_Rn01_00044662 predicted 976
7 SASI_Rn01_00044663 predicted 1328
8 SASI_Rn01_00044664 predicted 255
9 SASI_Rn01_00044665 predicted 963
10 SASI_Rn01_00044666 predicted 768
11 SASI_Rn01_00044667 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175435 predicted 626
2 SASI_Mm01_00175437 predicted 232
3 SASI_Mm02_00343388 predicted 854
4 SASI_Mm01_00175438 predicted 632
5 SASI_Mm01_00175439 predicted 663
6 SASI_Mm01_00175440 predicted 265
7 SASI_Mm01_00175441 predicted 630
8 SASI_Mm01_00175442 predicted 795
9 SASI_Mm01_00175443 predicted 815
10 SASI_Mm01_00175444 predicted 634
11 SASI_Mm01_00175436 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153580
VALIDATED
INO80E MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit E
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153580.1-726s21c1
Sequence:CCGGACGACCTGGTGATCGACATTCCTCGAGGAATGTCGATCACCAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153580.1-636s1c1
Sequence:CCGGCCAAGATGCCTCCACATACAACTCGAGTTGTATGTGGAGGCATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153580.1-208s21c1
Sequence:CCGGGGATGAAGACTCCTCTGATTCCTCGAGGAATCAGAGGAGTCTTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153580.1-815s1c1
Sequence:CCGGCCACTTCCTCAAGAGATGTTTCTCGAGAAACATCTCTTGAGGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153580.1-179s1c1
Sequence:CCGGCTAGATCGACTTCTGCAGTATCTCGAGATACTGCAGAAGTCGATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153580.1-233s21c1
Sequence:CCGGGCCACCGCATCTTCAGATAACCTCGAGGTTATCTGAAGATGCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153580.1-180s21c1
Sequence:CCGGTAGATCGACTTCTGCAGTATGCTCGAGCATACTGCAGAAGTCGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153580.1-815s21c1
Sequence:CCGGCCACTTCCTCAAGAGATGTTTCTCGAGAAACATCTCTTGAGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153580
VALIDATED
INO80E MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit E
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153580.1-726s21c1
Sequence:CCGGACGACCTGGTGATCGACATTCCTCGAGGAATGTCGATCACCAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153580.1-636s1c1
Sequence:CCGGCCAAGATGCCTCCACATACAACTCGAGTTGTATGTGGAGGCATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153580.1-208s21c1
Sequence:CCGGGGATGAAGACTCCTCTGATTCCTCGAGGAATCAGAGGAGTCTTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153580.1-815s1c1
Sequence:CCGGCCACTTCCTCAAGAGATGTTTCTCGAGAAACATCTCTTGAGGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153580.1-179s1c1
Sequence:CCGGCTAGATCGACTTCTGCAGTATCTCGAGATACTGCAGAAGTCGATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153580.1-233s21c1
Sequence:CCGGGCCACCGCATCTTCAGATAACCTCGAGGTTATCTGAAGATGCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153580.1-180s21c1
Sequence:CCGGTAGATCGACTTCTGCAGTATGCTCGAGCATACTGCAGAAGTCGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153580.1-815s21c1
Sequence:CCGGCCACTTCCTCAAGAGATGTTTCTCGAGAAACATCTCTTGAGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153580
VALIDATED
INO80E MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit E
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153580.1-726s21c1
Sequence:CCGGACGACCTGGTGATCGACATTCCTCGAGGAATGTCGATCACCAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153580.1-636s1c1
Sequence:CCGGCCAAGATGCCTCCACATACAACTCGAGTTGTATGTGGAGGCATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153580.1-208s21c1
Sequence:CCGGGGATGAAGACTCCTCTGATTCCTCGAGGAATCAGAGGAGTCTTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153580.1-815s1c1
Sequence:CCGGCCACTTCCTCAAGAGATGTTTCTCGAGAAACATCTCTTGAGGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153580.1-179s1c1
Sequence:CCGGCTAGATCGACTTCTGCAGTATCTCGAGATACTGCAGAAGTCGATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153580.1-233s21c1
Sequence:CCGGGCCACCGCATCTTCAGATAACCTCGAGGTTATCTGAAGATGCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153580.1-180s21c1
Sequence:CCGGTAGATCGACTTCTGCAGTATGCTCGAGCATACTGCAGAAGTCGATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153580.1-815s21c1
Sequence:CCGGCCACTTCCTCAAGAGATGTTTCTCGAGAAACATCTCTTGAGGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173618
VALIDATED
INO80E MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit E
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-276s1c1
Sequence:CCGGCAGTACGAGAACGTGGATGAACTCGAGTTCATCCACGTTCTCGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-282s1c1
Sequence:CCGGGAGAACGTGGATGAAGACTCTCTCGAGAGAGTCTTCATCCACGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-207s1c1
Sequence:CCGGCTGAGGAAAGCGCAAAGGAAACTCGAGTTTCCTTTGCGCTTTCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-218s1c1
Sequence:CCGGGCAAAGGAAATTACTGAAGGTCTCGAGACCTTCAGTAATTTCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-219s1c1
Sequence:CCGGCAAAGGAAATTACTGAAGGTGCTCGAGCACCTTCAGTAATTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-161s1c1
Sequence:CCGGGAAGCTCAAGTTCCTCATCTACTCGAGTAGATGAGGAACTTGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-149s1c1
Sequence:CCGGGAATCTGAAGCGGAAGCTCAACTCGAGTTGAGCTTCCGCTTCAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-294s1c1
Sequence:CCGGGAAGACTCTTCGGACTCAGATCTCGAGATCTGAGTCCGAAGAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-906s1c1
Sequence:CCGGGCTTCCTCGGAGGTGTTTATTCTCGAGAATAAACACCTCCGAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-291s1c1
Sequence:CCGGGATGAAGACTCTTCGGACTCACTCGAGTGAGTCCGAAGAGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-167s1c1
Sequence:CCGGCAAGTTCCTCATCTACGAGCACTCGAGTGCTCGTAGATGAGGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173618
VALIDATED
INO80E MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit E
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-276s1c1
Sequence:CCGGCAGTACGAGAACGTGGATGAACTCGAGTTCATCCACGTTCTCGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-282s1c1
Sequence:CCGGGAGAACGTGGATGAAGACTCTCTCGAGAGAGTCTTCATCCACGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-207s1c1
Sequence:CCGGCTGAGGAAAGCGCAAAGGAAACTCGAGTTTCCTTTGCGCTTTCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-218s1c1
Sequence:CCGGGCAAAGGAAATTACTGAAGGTCTCGAGACCTTCAGTAATTTCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-219s1c1
Sequence:CCGGCAAAGGAAATTACTGAAGGTGCTCGAGCACCTTCAGTAATTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-161s1c1
Sequence:CCGGGAAGCTCAAGTTCCTCATCTACTCGAGTAGATGAGGAACTTGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-149s1c1
Sequence:CCGGGAATCTGAAGCGGAAGCTCAACTCGAGTTGAGCTTCCGCTTCAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-294s1c1
Sequence:CCGGGAAGACTCTTCGGACTCAGATCTCGAGATCTGAGTCCGAAGAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-906s1c1
Sequence:CCGGGCTTCCTCGGAGGTGTTTATTCTCGAGAATAAACACCTCCGAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-291s1c1
Sequence:CCGGGATGAAGACTCTTCGGACTCACTCGAGTGAGTCCGAAGAGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-167s1c1
Sequence:CCGGCAAGTTCCTCATCTACGAGCACTCGAGTGCTCGTAGATGAGGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173618
VALIDATED
INO80E MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit E
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-276s1c1
Sequence:CCGGCAGTACGAGAACGTGGATGAACTCGAGTTCATCCACGTTCTCGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-282s1c1
Sequence:CCGGGAGAACGTGGATGAAGACTCTCTCGAGAGAGTCTTCATCCACGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-207s1c1
Sequence:CCGGCTGAGGAAAGCGCAAAGGAAACTCGAGTTTCCTTTGCGCTTTCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-218s1c1
Sequence:CCGGGCAAAGGAAATTACTGAAGGTCTCGAGACCTTCAGTAATTTCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-219s1c1
Sequence:CCGGCAAAGGAAATTACTGAAGGTGCTCGAGCACCTTCAGTAATTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-161s1c1
Sequence:CCGGGAAGCTCAAGTTCCTCATCTACTCGAGTAGATGAGGAACTTGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-149s1c1
Sequence:CCGGGAATCTGAAGCGGAAGCTCAACTCGAGTTGAGCTTCCGCTTCAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-294s1c1
Sequence:CCGGGAAGACTCTTCGGACTCAGATCTCGAGATCTGAGTCCGAAGAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-906s1c1
Sequence:CCGGGCTTCCTCGGAGGTGTTTATTCTCGAGAATAAACACCTCCGAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173618.1-291s1c1
Sequence:CCGGGATGAAGACTCTTCGGACTCACTCGAGTGAGTCCGAAGAGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173618.1-167s1c1
Sequence:CCGGCAAGTTCCTCATCTACGAGCACTCGAGTGCTCGTAGATGAGGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)