EMAIL THIS PAGE TO A FRIEND

INPP1

inositol polyphosphate-1-phosphatase

56 Gene Product Result for
UniProtKB ID: P49441
Gene ID:
Human(3628) Summary: This gene encodes the enzyme inositol polyphosphate-1-phosphatase, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 1 of the inositol ring from the polyphosphates inositol 1,4-bisphosphate and inositol 1,3,4-trisphophosphate. [provided by RefSeq, Jul 2008]
Mouse(16329) inositol polyphosphate-1-phosphatase
Rat(316376) inositol polyphosphate-1-phosphatase
dog(478842) inositol polyphosphate-1-phosphatase
cow(281869) inositol polyphosphate-1-phosphatase
Horse(100054603) inositol polyphosphate-1-phosphatase
domestic cat(101082081) inositol polyphosphate-1-phosphatase
sheep(101110908) inositol polyphosphate-1-phosphatase
Domestic Rabbit(100357992) inositol polyphosphate-1-phosphatase
domestic guinea pig(100725526) inositol polyphosphate-1-phosphatase
naked mole-rat(101724306) inositol polyphosphate-1-phosphatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002194 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002194 Rosetta Predictions human pricing
NM_001012131 Rosetta Predictions rat pricing
XM_576560 Rosetta Predictions rat pricing
NM_008384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112994 predicted 641
2 SASI_Hs01_00112995 predicted 454
3 SASI_Hs01_00112996 predicted 537
4 SASI_Hs01_00112997 predicted 502
5 SASI_Hs01_00112998 predicted 616
6 SASI_Hs01_00112999 predicted 1220
7 SASI_Hs01_00113000 predicted 1174
8 SASI_Hs01_00113001 predicted 585
9 SASI_Hs01_00113002 predicted 1081
10 SASI_Hs01_00113003 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115782 predicted 549
2 SASI_Rn01_00115783 predicted 293
3 SASI_Rn01_00115784 predicted 748
4 SASI_Rn01_00115785 predicted 633
5 SASI_Rn01_00115786 predicted 790
6 SASI_Rn01_00115787 predicted 395
7 SASI_Rn01_00115788 predicted 635
8 SASI_Rn01_00115789 predicted 1336
9 SASI_Rn01_00115790 predicted 1268
10 SASI_Rn01_00115791 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134770 predicted 932
2 SASI_Rn01_00134771 predicted 1132
3 SASI_Rn01_00134772 predicted 1013
4 SASI_Rn01_00134773 predicted 1181
5 SASI_Rn01_00134774 predicted 918
6 SASI_Rn01_00134775 predicted 781
7 SASI_Rn01_00134776 predicted 1014
8 SASI_Rn01_00134777 predicted 1656
9 SASI_Rn01_00134778 predicted 1324
10 SASI_Rn01_00134779 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184282 predicted 798
2 SASI_Mm02_00313760 predicted 1104
3 SASI_Mm01_00184283 predicted 861
4 SASI_Mm01_00184284 predicted 798
5 SASI_Mm01_00184285 predicted 563
6 SASI_Mm01_00184287 predicted 1325
7 SASI_Mm01_00184288 predicted 1435
8 SASI_Mm01_00184289 predicted 959
9 SASI_Mm01_00184290 predicted 1420
10 SASI_Mm01_00184291 predicted 799
11 SASI_Mm01_00184286 predicted 1360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002194
VALIDATED
INPP1 MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-1-phosphatase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002194.3-1794s21c1
Sequence:CCGGTGTGAAACTGTTTCGGTTATCCTCGAGGATAACCGAAACAGTTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1488s21c1
Sequence:CCGGCCACATTCAAATGGGACTCTTCTCGAGAAGAGTCCCATTTGAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1235s1c1
Sequence:CCGGCCACATTCAAATGGGACTCTTCTCGAGAAGAGTCCCATTTGAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-460s1c1
Sequence:CCGGGCTGATGTACTGGTACAGGAACTCGAGTTCCTGTACCAGTACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002194.3-1834s21c1
Sequence:GTACCGGTTTGTCCTGTTGCTGGTTAACCTCGAGGTTAACCAGCAACAGGACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1088s1c1
Sequence:CCGGCCGTAATTAGTACAAGTGAAACTCGAGTTTCACTTGTACTAATTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002194.2-619s1c1
Sequence:CCGGCTTCTTAGCAAAGTCCTCAATCTCGAGATTGAGGACTTTGCTAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1313s1c1
Sequence:CCGGGCTTAGAAAGAAATCCAGAAACTCGAGTTTCTGGATTTCTTTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1110s21c1
Sequence:GTACCGGTAATTGGTGTCTATGACATACCTCGAGGTATGTCATAGACACCAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1391s21c1
Sequence:CCGGGTGTGTGGAGATCGCATATTTCTCGAGAAATATGCGATCTCCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1566s21c1
Sequence:CCGGGCTTAGAAAGAAATCCAGAAACTCGAGTTTCTGGATTTCTTTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-713s21c1
Sequence:CCGGGCTGATGTACTGGTACAGGAACTCGAGTTCCTGTACCAGTACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002194
VALIDATED
INPP1 MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-1-phosphatase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002194.3-1794s21c1
Sequence:CCGGTGTGAAACTGTTTCGGTTATCCTCGAGGATAACCGAAACAGTTTCACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000292018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1488s21c1
Sequence:CCGGCCACATTCAAATGGGACTCTTCTCGAGAAGAGTCCCATTTGAATGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1235s1c1
Sequence:CCGGCCACATTCAAATGGGACTCTTCTCGAGAAGAGTCCCATTTGAATGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-460s1c1
Sequence:CCGGGCTGATGTACTGGTACAGGAACTCGAGTTCCTGTACCAGTACATCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000380168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002194.3-1834s21c1
Sequence:GTACCGGTTTGTCCTGTTGCTGGTTAACCTCGAGGTTAACCAGCAACAGGACAAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1088s1c1
Sequence:CCGGCCGTAATTAGTACAAGTGAAACTCGAGTTTCACTTGTACTAATTACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002194.2-619s1c1
Sequence:CCGGCTTCTTAGCAAAGTCCTCAATCTCGAGATTGAGGACTTTGCTAAGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1313s1c1
Sequence:CCGGGCTTAGAAAGAAATCCAGAAACTCGAGTTTCTGGATTTCTTTCTAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000379923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1110s21c1
Sequence:GTACCGGTAATTGGTGTCTATGACATACCTCGAGGTATGTCATAGACACCAATTATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000331329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1391s21c1
Sequence:CCGGGTGTGTGGAGATCGCATATTTCTCGAGAAATATGCGATCTCCACACACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000292020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1566s21c1
Sequence:CCGGGCTTAGAAAGAAATCCAGAAACTCGAGTTTCTGGATTTCTTTCTAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000292017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-713s21c1
Sequence:CCGGGCTGATGTACTGGTACAGGAACTCGAGTTCCTGTACCAGTACATCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002194
VALIDATED
INPP1 MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-1-phosphatase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002194.3-1794s21c1
Sequence:CCGGTGTGAAACTGTTTCGGTTATCCTCGAGGATAACCGAAACAGTTTCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1488s21c1
Sequence:CCGGCCACATTCAAATGGGACTCTTCTCGAGAAGAGTCCCATTTGAATGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1235s1c1
Sequence:CCGGCCACATTCAAATGGGACTCTTCTCGAGAAGAGTCCCATTTGAATGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-460s1c1
Sequence:CCGGGCTGATGTACTGGTACAGGAACTCGAGTTCCTGTACCAGTACATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002194.3-1834s21c1
Sequence:GTACCGGTTTGTCCTGTTGCTGGTTAACCTCGAGGTTAACCAGCAACAGGACAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1088s1c1
Sequence:CCGGCCGTAATTAGTACAAGTGAAACTCGAGTTTCACTTGTACTAATTACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002194.2-619s1c1
Sequence:CCGGCTTCTTAGCAAAGTCCTCAATCTCGAGATTGAGGACTTTGCTAAGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002194.2-1313s1c1
Sequence:CCGGGCTTAGAAAGAAATCCAGAAACTCGAGTTTCTGGATTTCTTTCTAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1110s21c1
Sequence:GTACCGGTAATTGGTGTCTATGACATACCTCGAGGTATGTCATAGACACCAATTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1391s21c1
Sequence:CCGGGTGTGTGGAGATCGCATATTTCTCGAGAAATATGCGATCTCCACACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-1566s21c1
Sequence:CCGGGCTTAGAAAGAAATCCAGAAACTCGAGTTTCTGGATTTCTTTCTAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002194.3-713s21c1
Sequence:CCGGGCTGATGTACTGGTACAGGAACTCGAGTTCCTGTACCAGTACATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008384
VALIDATED
INPP1 MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-1-phosphatase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-615s1c1
Sequence:CCGGCTCACGAGAGTCTTGGGATTTCTCGAGAAATCCCAAGACTCTCGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008384.1-1415s1c1
Sequence:CCGGTCCTGTTATCTCTTGAAGATACTCGAGTATCTTCAAGAGATAACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-1169s1c1
Sequence:CCGGGTAGACATGAAAGAGTGCTTACTCGAGTAAGCACTCTTTCATGTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-680s1c1
Sequence:CCGGGCCAATGTTAAATCCAACCAACTCGAGTTGGTTGGATTTAACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008384.1-1057s1c1
Sequence:CCGGCCTCTGTGTAATCCAAGGCTTCTCGAGAAGCCTTGGATTACACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-650s21c1
Sequence:CCGGGCTTCTCAGCAAGGTCCTTAACTCGAGTTAAGGACCTTGCTGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-831s21c1
Sequence:CCGGGCCAATGTTAAATCCAACCAACTCGAGTTGGTTGGATTTAACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-709s21c1
Sequence:CCGGTTCATGAGGACGTGGACTTAACTCGAGTTAAGTCCACGTCCTCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008384.2-1542s21c1
Sequence:CCGGCCTTCAGCCGAACTGCATCTTCTCGAGAAGATGCAGTTCGGCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-799s21c1
Sequence:CCGGTTGATTCAACCTATCAGTATACTCGAGTATACTGATAGGTTGAATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008384
VALIDATED
INPP1 MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-1-phosphatase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-615s1c1
Sequence:CCGGCTCACGAGAGTCTTGGGATTTCTCGAGAAATCCCAAGACTCTCGTGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008384.1-1415s1c1
Sequence:CCGGTCCTGTTATCTCTTGAAGATACTCGAGTATCTTCAAGAGATAACAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-1169s1c1
Sequence:CCGGGTAGACATGAAAGAGTGCTTACTCGAGTAAGCACTCTTTCATGTCTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-680s1c1
Sequence:CCGGGCCAATGTTAAATCCAACCAACTCGAGTTGGTTGGATTTAACATTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008384.1-1057s1c1
Sequence:CCGGCCTCTGTGTAATCCAAGGCTTCTCGAGAAGCCTTGGATTACACAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-650s21c1
Sequence:CCGGGCTTCTCAGCAAGGTCCTTAACTCGAGTTAAGGACCTTGCTGAGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000317893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-831s21c1
Sequence:CCGGGCCAATGTTAAATCCAACCAACTCGAGTTGGTTGGATTTAACATTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-709s21c1
Sequence:CCGGTTCATGAGGACGTGGACTTAACTCGAGTTAAGTCCACGTCCTCATGAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008384.2-1542s21c1
Sequence:CCGGCCTTCAGCCGAACTGCATCTTCTCGAGAAGATGCAGTTCGGCTGAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-799s21c1
Sequence:CCGGTTGATTCAACCTATCAGTATACTCGAGTATACTGATAGGTTGAATCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008384
VALIDATED
INPP1 MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-1-phosphatase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-615s1c1
Sequence:CCGGCTCACGAGAGTCTTGGGATTTCTCGAGAAATCCCAAGACTCTCGTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008384.1-1415s1c1
Sequence:CCGGTCCTGTTATCTCTTGAAGATACTCGAGTATCTTCAAGAGATAACAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-1169s1c1
Sequence:CCGGGTAGACATGAAAGAGTGCTTACTCGAGTAAGCACTCTTTCATGTCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008384.1-680s1c1
Sequence:CCGGGCCAATGTTAAATCCAACCAACTCGAGTTGGTTGGATTTAACATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008384.1-1057s1c1
Sequence:CCGGCCTCTGTGTAATCCAAGGCTTCTCGAGAAGCCTTGGATTACACAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-650s21c1
Sequence:CCGGGCTTCTCAGCAAGGTCCTTAACTCGAGTTAAGGACCTTGCTGAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-831s21c1
Sequence:CCGGGCCAATGTTAAATCCAACCAACTCGAGTTGGTTGGATTTAACATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-709s21c1
Sequence:CCGGTTCATGAGGACGTGGACTTAACTCGAGTTAAGTCCACGTCCTCATGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008384.2-1542s21c1
Sequence:CCGGCCTTCAGCCGAACTGCATCTTCTCGAGAAGATGCAGTTCGGCTGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008384.2-799s21c1
Sequence:CCGGTTGATTCAACCTATCAGTATACTCGAGTATACTGATAGGTTGAATCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)