EMAIL THIS PAGE TO A FRIEND

INPP4A

inositol polyphosphate-4-phosphatase, type I, 107kDa

86 Gene Product Result for
Synonyms: INPP4 TVAS1
UniProtKB ID: Q96PE3, O15326, Q13187, Q53TD8, Q8TC02
Gene ID:
Human(3631) Summary: This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
Mouse(269180) inositol polyphosphate-4-phosphatase, type I
Rat(80849) inositol polyphosphate-4-phosphatase, type I
chicken(418690) inositol polyphosphate-4-phosphatase, type I, 107kDa
dog(474563) inositol polyphosphate-4-phosphatase, type I, 107kDa
cow(535487) inositol polyphosphate-4-phosphatase, type I, 107kDa
Horse(100051038) inositol polyphosphate-4-phosphatase, type I, 107kDa
domestic cat(101088920) inositol polyphosphate-4-phosphatase, type I, 107kDa
domestic guinea pig(100727592) inositol polyphosphate-4-phosphatase, type I, 107kDa
naked mole-rat(101718534) inositol polyphosphate-4-phosphatase, type I, 107kDa
sheep(101109605) inositol polyphosphate-4-phosphatase, type I, 107kDa
Domestic Rabbit(100340475) inositol polyphosphate-4-phosphatase, type I, 107kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001566 Rosetta Predictions human pricing
NM_004027 Rosetta Predictions human pricing
NM_031002 Rosetta Predictions rat pricing
NM_030266 Rosetta Predictions mouse pricing
NM_172971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111009 predicted 471
2 SASI_Hs01_00111010 predicted 2672
3 SASI_Hs01_00111011 predicted 2434
4 SASI_Hs01_00111012 predicted 2113
5 SASI_Hs01_00111013 predicted 1163
6 SASI_Hs01_00111015 predicted 660
7 SASI_Hs01_00111016 predicted 2559
8 SASI_Hs01_00111017 predicted 2454
9 SASI_Hs01_00111018 predicted 2648
10 SASI_Hs02_00332137 predicted 696
11 SASI_Hs01_00111014 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029478 predicted 470
2 SASI_Hs01_00029479 predicted 2666
3 SASI_Hs01_00029480 predicted 2438
4 SASI_Hs01_00029481 predicted 2118
5 SASI_Hs01_00029482 predicted 1164
6 SASI_Hs01_00029484 predicted 662
7 SASI_Hs01_00029485 predicted 2561
8 SASI_Hs01_00029486 predicted 2457
9 SASI_Hs01_00029487 predicted 2650
10 SASI_Hs02_00336774 predicted 700
11 SASI_Hs01_00029483 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264178 predicted 654
2 SASI_Rn01_00061763 predicted 2613
3 SASI_Rn01_00061764 predicted 846
4 SASI_Rn01_00061765 predicted 2837
5 SASI_Rn01_00061766 predicted 557
6 SASI_Rn01_00061767 predicted 632
7 SASI_Rn01_00061769 predicted 2386
8 SASI_Rn01_00061770 predicted 2428
9 SASI_Rn02_00264179 predicted 3048
10 SASI_Rn02_00264180 predicted 3137
11 SASI_Rn01_00061768 predicted 1521
12 SASI_Rn01_00061771 predicted 1289
13 SASI_Rn01_00061772 predicted 2905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068584 predicted 1563
2 SASI_Mm02_00336750 predicted 2723
3 SASI_Mm02_00336751 predicted 2330
4 SASI_Mm01_00068589 predicted 1622
5 SASI_Mm02_00336752 predicted 2492
6 SASI_Mm02_00336753 predicted 2553
7 SASI_Mm01_00068591 predicted 1662
8 SASI_Mm01_00068592 predicted 1442
9 SASI_Mm02_00336754 predicted 2524
10 SASI_Mm01_00068593 predicted 1407
11 SASI_Mm01_00068585 predicted 1092
12 SASI_Mm01_00068586 predicted 1236
13 SASI_Mm01_00068587 predicted 1176
14 SASI_Mm01_00068588 predicted 1201
15 SASI_Mm01_00068590 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067766 predicted 488
2 SASI_Mm02_00345017 predicted 1647
3 SASI_Mm02_00345018 predicted 1263
4 SASI_Mm01_00067771 predicted 555
5 SASI_Mm02_00345019 predicted 1415
6 SASI_Mm02_00345020 predicted 1484
7 SASI_Mm01_00067773 predicted 598
8 SASI_Mm01_00067774 predicted 373
9 SASI_Mm02_00345021 predicted 1445
10 SASI_Mm01_00067775 predicted 326
11 SASI_Mm01_00067767 predicted 414
12 SASI_Mm01_00067768 predicted 561
13 SASI_Mm01_00067769 predicted 492
14 SASI_Mm01_00067770 predicted 518
15 SASI_Mm01_00067772 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004027
VALIDATED
INPP4A MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-4-phosphatase, type I, 107kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-564s21c1
Sequence:CCGGGGGAACCAACAATCCTATATTCTCGAGAATATAGGATTGTTGGTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-1237s21c1
Sequence:CCGGTACAGAGGGCCCTCGTTTAAACTCGAGTTTAAACGAGGGCCCTCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-2650s21c1
Sequence:CCGGGAGAGTTTGGTGCGGTTAAATCTCGAGATTTAACCGCACCAAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-1188s1c1
Sequence:CCGGCCAGACCATCATCCTCACATACTCGAGTATGTGAGGATGATGGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-2569s1c1
Sequence:CCGGCTCTTCAACGTGGGCATCAATCTCGAGATTGATGCCCACGTTGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004027.x-2781s1c1
Sequence:CCGGCCGGAAGAATAAGAACGTCGACTCGAGTCGACGTTCTTATTCTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-2106s1c1
Sequence:CCGGGATGAGTGACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTCACTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-643s1c1
Sequence:CCGGCTCTCCGTGTATGATGTCAAACTCGAGTTTGACATCATACACGGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004027.1-2611s21c1
Sequence:CCGGAGGTTTGGCGATACGTCTTTACTCGAGTAAAGACGTATCGCCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004027
VALIDATED
INPP4A MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-4-phosphatase, type I, 107kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-564s21c1
Sequence:CCGGGGGAACCAACAATCCTATATTCTCGAGAATATAGGATTGTTGGTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-1237s21c1
Sequence:CCGGTACAGAGGGCCCTCGTTTAAACTCGAGTTTAAACGAGGGCCCTCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-2650s21c1
Sequence:CCGGGAGAGTTTGGTGCGGTTAAATCTCGAGATTTAACCGCACCAAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-1188s1c1
Sequence:CCGGCCAGACCATCATCCTCACATACTCGAGTATGTGAGGATGATGGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-2569s1c1
Sequence:CCGGCTCTTCAACGTGGGCATCAATCTCGAGATTGATGCCCACGTTGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004027.x-2781s1c1
Sequence:CCGGCCGGAAGAATAAGAACGTCGACTCGAGTCGACGTTCTTATTCTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-2106s1c1
Sequence:CCGGGATGAGTGACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTCACTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-643s1c1
Sequence:CCGGCTCTCCGTGTATGATGTCAAACTCGAGTTTGACATCATACACGGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004027.1-2611s21c1
Sequence:CCGGAGGTTTGGCGATACGTCTTTACTCGAGTAAAGACGTATCGCCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004027
VALIDATED
INPP4A MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-4-phosphatase, type I, 107kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-564s21c1
Sequence:CCGGGGGAACCAACAATCCTATATTCTCGAGAATATAGGATTGTTGGTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-1237s21c1
Sequence:CCGGTACAGAGGGCCCTCGTTTAAACTCGAGTTTAAACGAGGGCCCTCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004027.1-2650s21c1
Sequence:CCGGGAGAGTTTGGTGCGGTTAAATCTCGAGATTTAACCGCACCAAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-1188s1c1
Sequence:CCGGCCAGACCATCATCCTCACATACTCGAGTATGTGAGGATGATGGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-2569s1c1
Sequence:CCGGCTCTTCAACGTGGGCATCAATCTCGAGATTGATGCCCACGTTGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004027.x-2781s1c1
Sequence:CCGGCCGGAAGAATAAGAACGTCGACTCGAGTCGACGTTCTTATTCTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-2106s1c1
Sequence:CCGGGATGAGTGACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTCACTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004027.x-643s1c1
Sequence:CCGGCTCTCCGTGTATGATGTCAAACTCGAGTTTGACATCATACACGGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004027.1-2611s21c1
Sequence:CCGGAGGTTTGGCGATACGTCTTTACTCGAGTAAAGACGTATCGCCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030266
VALIDATED
INPP4A MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-4-phosphatase, type I, 107kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-2493s1c1
Sequence:CCGGCAAGAATAAGAATGTGGACATCTCGAGATGTCCACATTCTTATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-614s1c1
Sequence:CCGGCCTTGGGAATCCGATCCAAATCTCGAGATTTGGATCGGATTCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-304s1c1
Sequence:CCGGGCCTTCTTTCAAGACTCCCTTCTCGAGAAGGGAGTCTTGAAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-103s1c1
Sequence:CCGGGCAGGAAATATCCAAGATCCACTCGAGTGGATCTTGGATATTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-1024s1c1
Sequence:CCGGCGGATGCGAGTTCAAGATGATCTCGAGATCATCTTGAACTCGCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-615s1c2
Sequence:CCGGCTTGGGAATCCGATCCAAATACTCGAGTATTTGGATCGGATTCCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-1206s1c1
Sequence:CCGGCATCTACATACCACAGGACATCTCGAGATGTCCTGTGGTATGTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030266.2-3259s1c1
Sequence:CCGGCTGTAGTGTCACATAAGATTCCTCGAGGAATCTTATGTGACACTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030266.2-3388s1c1
Sequence:CCGGGTCAATAGCGTGGATAGTAATCTCGAGATTACTATCCACGCTATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-283s1c1
Sequence:CCGGCCTATCTTTCTAAGCAGCATTCTCGAGAATGCTGCTTAGAAAGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030266
VALIDATED
INPP4A MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-4-phosphatase, type I, 107kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-2493s1c1
Sequence:CCGGCAAGAATAAGAATGTGGACATCTCGAGATGTCCACATTCTTATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-614s1c1
Sequence:CCGGCCTTGGGAATCCGATCCAAATCTCGAGATTTGGATCGGATTCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-304s1c1
Sequence:CCGGGCCTTCTTTCAAGACTCCCTTCTCGAGAAGGGAGTCTTGAAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-103s1c1
Sequence:CCGGGCAGGAAATATCCAAGATCCACTCGAGTGGATCTTGGATATTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-1024s1c1
Sequence:CCGGCGGATGCGAGTTCAAGATGATCTCGAGATCATCTTGAACTCGCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-615s1c2
Sequence:CCGGCTTGGGAATCCGATCCAAATACTCGAGTATTTGGATCGGATTCCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-1206s1c1
Sequence:CCGGCATCTACATACCACAGGACATCTCGAGATGTCCTGTGGTATGTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030266.2-3259s1c1
Sequence:CCGGCTGTAGTGTCACATAAGATTCCTCGAGGAATCTTATGTGACACTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030266.2-3388s1c1
Sequence:CCGGGTCAATAGCGTGGATAGTAATCTCGAGATTACTATCCACGCTATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-283s1c1
Sequence:CCGGCCTATCTTTCTAAGCAGCATTCTCGAGAATGCTGCTTAGAAAGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030266
VALIDATED
INPP4A MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-4-phosphatase, type I, 107kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-2493s1c1
Sequence:CCGGCAAGAATAAGAATGTGGACATCTCGAGATGTCCACATTCTTATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-614s1c1
Sequence:CCGGCCTTGGGAATCCGATCCAAATCTCGAGATTTGGATCGGATTCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-304s1c1
Sequence:CCGGGCCTTCTTTCAAGACTCCCTTCTCGAGAAGGGAGTCTTGAAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-103s1c1
Sequence:CCGGGCAGGAAATATCCAAGATCCACTCGAGTGGATCTTGGATATTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-1024s1c1
Sequence:CCGGCGGATGCGAGTTCAAGATGATCTCGAGATCATCTTGAACTCGCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030266.1-615s1c2
Sequence:CCGGCTTGGGAATCCGATCCAAATACTCGAGTATTTGGATCGGATTCCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-1206s1c1
Sequence:CCGGCATCTACATACCACAGGACATCTCGAGATGTCCTGTGGTATGTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030266.2-3259s1c1
Sequence:CCGGCTGTAGTGTCACATAAGATTCCTCGAGGAATCTTATGTGACACTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030266.2-3388s1c1
Sequence:CCGGGTCAATAGCGTGGATAGTAATCTCGAGATTACTATCCACGCTATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030266.1-283s1c1
Sequence:CCGGCCTATCTTTCTAAGCAGCATTCTCGAGAATGCTGCTTAGAAAGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001566
VALIDATED
INPP4A MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-4-phosphatase, type I, 107kDa
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000000540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001566.x-2569s1c1
Sequence:CCGGCTCTTCAACGTGGGCATCAATCTCGAGATTGATGCCCACGTTGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001566.x-2781s1c1
Sequence:CCGGCCGGAAGAATAAGAACGTCGACTCGAGTCGACGTTCTTATTCTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001566.x-643s1c1
Sequence:CCGGCTCTCCGTGTATGATGTCAAACTCGAGTTTGACATCATACACGGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001566.x-1188s1c1
Sequence:CCGGCCAGACCATCATCCTCACATACTCGAGTATGTGAGGATGATGGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001566
VALIDATED
INPP4A MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-4-phosphatase, type I, 107kDa
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000000540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001566.x-2569s1c1
Sequence:CCGGCTCTTCAACGTGGGCATCAATCTCGAGATTGATGCCCACGTTGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001566.x-2781s1c1
Sequence:CCGGCCGGAAGAATAAGAACGTCGACTCGAGTCGACGTTCTTATTCTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001566.x-643s1c1
Sequence:CCGGCTCTCCGTGTATGATGTCAAACTCGAGTTTGACATCATACACGGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001566.x-1188s1c1
Sequence:CCGGCCAGACCATCATCCTCACATACTCGAGTATGTGAGGATGATGGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001566
VALIDATED
INPP4A MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-4-phosphatase, type I, 107kDa
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000000540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001566.x-2569s1c1
Sequence:CCGGCTCTTCAACGTGGGCATCAATCTCGAGATTGATGCCCACGTTGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001566.x-2781s1c1
Sequence:CCGGCCGGAAGAATAAGAACGTCGACTCGAGTCGACGTTCTTATTCTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001566.x-643s1c1
Sequence:CCGGCTCTCCGTGTATGATGTCAAACTCGAGTTTGACATCATACACGGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001566.x-1188s1c1
Sequence:CCGGCCAGACCATCATCCTCACATACTCGAGTATGTGAGGATGATGGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)