EMAIL THIS PAGE TO A FRIEND

INPP4B

inositol polyphosphate-4-phosphatase, type II, 105kDa

75 Gene Product Result for
UniProtKB ID: O15327, Q2TAI2, Q6IN59, Q6PJB4
Gene ID:
Human(8821) Summary: INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
Mouse(234515) inositol polyphosphate-4-phosphatase, type II
Rat(116699) inositol polyphosphate-4-phosphatase, type II
Zebrafish(560006) inositol polyphosphate-4-phosphatase, type II
chicken(422454) inositol polyphosphate-4-phosphatase, type II, 105kDa
cow(534793) inositol polyphosphate-4-phosphatase, type II, 105kDa
Horse(100062978) inositol polyphosphate-4-phosphatase, type II, 105kDa
domestic cat(101089005) inositol polyphosphate-4-phosphatase, type II, 105kDa
dog(476072) inositol polyphosphate-4-phosphatase, type II, 105kDa
sheep(101112848) inositol polyphosphate-4-phosphatase, type II, 105kDa
Domestic Rabbit(100348588) inositol polyphosphate-4-phosphatase, type II, 105kDa
domestic guinea pig(100731049) inositol polyphosphate-4-phosphatase, type II, 105kDa
naked mole-rat(101719238) inositol polyphosphate-4-phosphatase, type II, 105kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_134427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101669 Rosetta Predictions human pricing
NM_003866 Rosetta Predictions human pricing
NM_053917 Rosetta Predictions rat pricing
NM_001024617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322913 predicted 2754
2 SASI_Hs02_00322914 predicted 1221
3 SASI_Hs02_00322915 predicted 3310
4 SASI_Hs02_00322916 predicted 787
5 SASI_Hs02_00322917 predicted 773
6 SASI_Hs02_00322918 predicted 2386
7 SASI_Hs02_00322919 predicted 2658
8 SASI_Hs02_00322920 predicted 1614
9 SASI_Hs02_00322921 predicted 1394
10 SASI_Hs02_00322922 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171160 predicted 2853
2 SASI_Hs01_00171161 predicted 1323
3 SASI_Hs02_00336445 predicted 3409
4 SASI_Hs01_00171164 predicted 891
5 SASI_Hs02_00336446 predicted 879
6 SASI_Hs01_00171166 predicted 2489
7 SASI_Hs01_00171168 predicted 2762
8 SASI_Hs02_00336447 predicted 1714
9 SASI_Hs02_00336448 predicted 1488
10 SASI_Hs02_00336449 predicted 2115
11 SASI_Hs01_00171159 predicted 2621
12 SASI_Hs01_00171162 predicted 2701
13 SASI_Hs01_00171163 predicted 462
14 SASI_Hs01_00171165 predicted 2108
15 SASI_Hs01_00171167 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096050 predicted 718
2 SASI_Rn01_00096051 predicted 1206
3 SASI_Rn01_00096052 predicted 1295
4 SASI_Rn01_00096053 predicted 617
5 SASI_Rn01_00096054 predicted 633
6 SASI_Rn01_00096055 predicted 1962
7 SASI_Rn02_00266859 predicted 2247
8 SASI_Rn01_00096058 predicted 1966
9 SASI_Rn02_00266860 predicted 704
10 SASI_Rn01_00096059 predicted 2749
11 SASI_Rn01_00096056 predicted 1714
12 SASI_Rn01_00096057 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068705 predicted 2413
2 SASI_Mm02_00287630 predicted 419
3 SASI_Mm01_00068706 predicted 2503
4 SASI_Mm01_00068708 predicted 2627
5 SASI_Mm01_00068709 predicted 742
6 SASI_Mm01_00068711 predicted 2421
7 SASI_Mm01_00068713 predicted 1260
8 SASI_Mm02_00287631 predicted 1316
9 SASI_Mm02_00287632 predicted 2047
10 SASI_Mm02_00287633 predicted 856
11 SASI_Mm01_00068704 predicted 2002
12 SASI_Mm01_00068707 predicted 954
13 SASI_Mm01_00068710 predicted 1646
14 SASI_Mm01_00068712 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003866
VALIDATED
INPP4B MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-4-phosphatase, type II, 105kDa
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003866.2-3855s21c1
Sequence:GTACCGGCACTCAATTAGGTAGAGTTAACTCGAGTTAACTCTACCTAATTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-778s21c1
Sequence:GTACCGGACTGGTGCAGATCTCCGTAATCTCGAGATTACGGAGATCTGCACCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-3087s21c1
Sequence:GTACCGGGCCGCAAACTGAATGGTATTCCTCGAGGAATACCATTCAGTTTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-416s1c1
Sequence:CCGGCCATCTGAGTATCCCATCTATCTCGAGATAGATGGGATACTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003866.1-2288s1c1
Sequence:CCGGGCCAGAATGTTTGAGTCACTACTCGAGTAGTGACTCAAACATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003866.1-2223s1c1
Sequence:CCGGCCAATGATGTATTGCCAGTTACTCGAGTAACTGGCAATACATCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-930s1c1
Sequence:CCGGCCCTTCACATTAAAGAAGATTCTCGAGAATCTTCTTTAATGTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-2486s1c1
Sequence:CCGGCCTCCTGATTATATTTCACATCTCGAGATGTGAAATATAATCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-1007s21c1
Sequence:GTACCGGCCAGAAGTTGGGCGAAGTTTCCTCGAGGAAACTTCGCCCAACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-2184s21c1
Sequence:GTACCGGAGAGCCTGAACTGCATTATTGCTCGAGCAATAATGCAGTTCAGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-2700s21c1
Sequence:GTACCGGATGATGTGTTGCCAGTTATAACTCGAGTTATAACTGGCAACACATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-2643s21c1
Sequence:CCGGCCGTTGGCATTTCCGATTTAACTCGAGTTAAATCGGAAATGCCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-1776s21c1
Sequence:CCGGATACCGGATACCAGTTTATTTCTCGAGAAATAAACTGGTATCCGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-824s21c1
Sequence:CCGGAGATACTCCAGCACCGAAATTCTCGAGAATTTCGGTGCTGGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-3674s21c1
Sequence:CCGGCTGAGGAAACATGGATCATTTCTCGAGAAATGATCCATGTTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-749s21c1
Sequence:GTACCGGGCTCCTGTCCGTGATCGTAAACTCGAGTTTACGATCACGGACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-1848s21c1
Sequence:GTACCGGATCAACTACAACCTCTTATAGCTCGAGCTATAAGAGGTTGTAGTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003866
VALIDATED
INPP4B MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-4-phosphatase, type II, 105kDa
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003866.2-3855s21c1
Sequence:GTACCGGCACTCAATTAGGTAGAGTTAACTCGAGTTAACTCTACCTAATTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-778s21c1
Sequence:GTACCGGACTGGTGCAGATCTCCGTAATCTCGAGATTACGGAGATCTGCACCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-3087s21c1
Sequence:GTACCGGGCCGCAAACTGAATGGTATTCCTCGAGGAATACCATTCAGTTTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-416s1c1
Sequence:CCGGCCATCTGAGTATCCCATCTATCTCGAGATAGATGGGATACTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003866.1-2288s1c1
Sequence:CCGGGCCAGAATGTTTGAGTCACTACTCGAGTAGTGACTCAAACATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003866.1-2223s1c1
Sequence:CCGGCCAATGATGTATTGCCAGTTACTCGAGTAACTGGCAATACATCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-930s1c1
Sequence:CCGGCCCTTCACATTAAAGAAGATTCTCGAGAATCTTCTTTAATGTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-2486s1c1
Sequence:CCGGCCTCCTGATTATATTTCACATCTCGAGATGTGAAATATAATCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-1007s21c1
Sequence:GTACCGGCCAGAAGTTGGGCGAAGTTTCCTCGAGGAAACTTCGCCCAACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-2184s21c1
Sequence:GTACCGGAGAGCCTGAACTGCATTATTGCTCGAGCAATAATGCAGTTCAGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-2700s21c1
Sequence:GTACCGGATGATGTGTTGCCAGTTATAACTCGAGTTATAACTGGCAACACATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-2643s21c1
Sequence:CCGGCCGTTGGCATTTCCGATTTAACTCGAGTTAAATCGGAAATGCCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-1776s21c1
Sequence:CCGGATACCGGATACCAGTTTATTTCTCGAGAAATAAACTGGTATCCGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-824s21c1
Sequence:CCGGAGATACTCCAGCACCGAAATTCTCGAGAATTTCGGTGCTGGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-3674s21c1
Sequence:CCGGCTGAGGAAACATGGATCATTTCTCGAGAAATGATCCATGTTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-749s21c1
Sequence:GTACCGGGCTCCTGTCCGTGATCGTAAACTCGAGTTTACGATCACGGACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-1848s21c1
Sequence:GTACCGGATCAACTACAACCTCTTATAGCTCGAGCTATAAGAGGTTGTAGTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003866
VALIDATED
INPP4B MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-4-phosphatase, type II, 105kDa
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003866.2-3855s21c1
Sequence:GTACCGGCACTCAATTAGGTAGAGTTAACTCGAGTTAACTCTACCTAATTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-778s21c1
Sequence:GTACCGGACTGGTGCAGATCTCCGTAATCTCGAGATTACGGAGATCTGCACCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-3087s21c1
Sequence:GTACCGGGCCGCAAACTGAATGGTATTCCTCGAGGAATACCATTCAGTTTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-416s1c1
Sequence:CCGGCCATCTGAGTATCCCATCTATCTCGAGATAGATGGGATACTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003866.1-2288s1c1
Sequence:CCGGGCCAGAATGTTTGAGTCACTACTCGAGTAGTGACTCAAACATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003866.1-2223s1c1
Sequence:CCGGCCAATGATGTATTGCCAGTTACTCGAGTAACTGGCAATACATCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-930s1c1
Sequence:CCGGCCCTTCACATTAAAGAAGATTCTCGAGAATCTTCTTTAATGTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003866.1-2486s1c1
Sequence:CCGGCCTCCTGATTATATTTCACATCTCGAGATGTGAAATATAATCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-1007s21c1
Sequence:GTACCGGCCAGAAGTTGGGCGAAGTTTCCTCGAGGAAACTTCGCCCAACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-2184s21c1
Sequence:GTACCGGAGAGCCTGAACTGCATTATTGCTCGAGCAATAATGCAGTTCAGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-2700s21c1
Sequence:GTACCGGATGATGTGTTGCCAGTTATAACTCGAGTTATAACTGGCAACACATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-2643s21c1
Sequence:CCGGCCGTTGGCATTTCCGATTTAACTCGAGTTAAATCGGAAATGCCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-1776s21c1
Sequence:CCGGATACCGGATACCAGTTTATTTCTCGAGAAATAAACTGGTATCCGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-824s21c1
Sequence:CCGGAGATACTCCAGCACCGAAATTCTCGAGAATTTCGGTGCTGGAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003866.2-3674s21c1
Sequence:CCGGCTGAGGAAACATGGATCATTTCTCGAGAAATGATCCATGTTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-749s21c1
Sequence:GTACCGGGCTCCTGTCCGTGATCGTAAACTCGAGTTTACGATCACGGACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003866.2-1848s21c1
Sequence:GTACCGGATCAACTACAACCTCTTATAGCTCGAGCTATAAGAGGTTGTAGTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134427
INPP4B MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-4-phosphatase, type II, 105kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134427.4-3094s1c1
Sequence:CCGGCCAGTCTATCTGTTCTCCTTTCTCGAGAAAGGAGAACAGATAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-1082s1c1
Sequence:CCGGCCAAAGAAACAGGGTCCTCTTCTCGAGAAGAGGACCCTGTTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-2787s1c1
Sequence:CCGGCCGCATAGAGAATGTACTGAACTCGAGTTCAGTACATTCTCTATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-919s1c1
Sequence:CCGGCCTAAGGAATTGATTTCCCTTCTCGAGAAGGGAAATCAATTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-2364s1c1
Sequence:CCGGCGTTCTGTTTAATGTCGGAATCTCGAGATTCCGACATTAAACAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134427
INPP4B MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-4-phosphatase, type II, 105kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134427.4-3094s1c1
Sequence:CCGGCCAGTCTATCTGTTCTCCTTTCTCGAGAAAGGAGAACAGATAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-1082s1c1
Sequence:CCGGCCAAAGAAACAGGGTCCTCTTCTCGAGAAGAGGACCCTGTTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-2787s1c1
Sequence:CCGGCCGCATAGAGAATGTACTGAACTCGAGTTCAGTACATTCTCTATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-919s1c1
Sequence:CCGGCCTAAGGAATTGATTTCCCTTCTCGAGAAGGGAAATCAATTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-2364s1c1
Sequence:CCGGCGTTCTGTTTAATGTCGGAATCTCGAGATTCCGACATTAAACAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134427
INPP4B MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-4-phosphatase, type II, 105kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134427.4-3094s1c1
Sequence:CCGGCCAGTCTATCTGTTCTCCTTTCTCGAGAAAGGAGAACAGATAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-1082s1c1
Sequence:CCGGCCAAAGAAACAGGGTCCTCTTCTCGAGAAGAGGACCCTGTTTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-2787s1c1
Sequence:CCGGCCGCATAGAGAATGTACTGAACTCGAGTTCAGTACATTCTCTATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-919s1c1
Sequence:CCGGCCTAAGGAATTGATTTCCCTTCTCGAGAAGGGAAATCAATTCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134427.4-2364s1c1
Sequence:CCGGCGTTCTGTTTAATGTCGGAATCTCGAGATTCCGACATTAAACAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)