EMAIL THIS PAGE TO A FRIEND

INPP5A

inositol polyphosphate-5-phosphatase, 40kDa

91 Gene Product Result for
Synonyms: 5PTASE
UniProtKB ID: Q14642, D3DXI3, Q14640, Q5JSF1
Gene ID:
Human(3632) Summary: The protein encoded by this gene is a membrane-associated type I inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. [provided by RefSeq, Jul 2008]
Mouse(212111) inositol polyphosphate-5-phosphatase A
Rat(365382) inositol polyphosphate-5-phosphatase A
domestic guinea pig(100729042) inositol polyphosphate-5-phosphatase, 40kDa
naked mole-rat(101704617) inositol polyphosphate-5-phosphatase, 40kDa
chicken(423973) inositol polyphosphate-5-phosphatase, 40kDa
dog(403937) inositol polyphosphate-5-phosphatase, 40kDa
Horse(100051027) inositol polyphosphate-5-phosphatase, 40kDa
cow(615232) inositol polyphosphate-5-phosphatase, 40kDa
domestic cat(101083037) inositol polyphosphate-5-phosphatase, 40kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005539 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005539 Rosetta Predictions human pricing
NM_001108923 Rosetta Predictions rat pricing
NM_001127363 Rosetta Predictions mouse pricing
NM_183144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178835 predicted 545
2 SASI_Hs01_00178836 predicted 911
3 SASI_Hs01_00178837 predicted 1070
4 SASI_Hs01_00178838 predicted 889
5 SASI_Hs01_00178839 predicted 903
6 SASI_Hs01_00178840 predicted 772
7 SASI_Hs01_00178841 predicted 1066
8 SASI_Hs01_00178842 predicted 458
9 SASI_Hs01_00178843 predicted 1151
10 SASI_Hs02_00339777 predicted 824
11 SASI_Hs01_00178844 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243414 predicted 601
2 SASI_Rn02_00243415 predicted 932
3 SASI_Rn02_00243416 predicted 1081
4 SASI_Rn02_00243417 predicted 973
5 SASI_Rn02_00243418 predicted 499
6 SASI_Rn02_00243419 predicted 1619
7 SASI_Rn02_00243420 predicted 1126
8 SASI_Rn02_00243421 predicted 1490
9 SASI_Rn02_00243422 predicted 1602
10 SASI_Rn02_00243423 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310347 predicted 416
2 SASI_Mm02_00310348 predicted 950
3 SASI_Mm02_00310349 predicted 569
4 SASI_Mm02_00310350 predicted 1217
5 SASI_Mm02_00310351 predicted 1058
6 SASI_Mm02_00310352 predicted 639
7 SASI_Mm02_00310353 predicted 738
8 SASI_Mm02_00310354 predicted 1222
9 SASI_Mm02_00310355 predicted 1073
10 SASI_Mm02_00310356 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027147 predicted 414
2 SASI_Mm01_00027148 predicted 948
3 SASI_Mm01_00027149 predicted 577
4 SASI_Mm01_00027150 predicted 1223
5 SASI_Mm01_00027151 predicted 1063
6 SASI_Mm02_00350168 predicted 640
7 SASI_Mm01_00027153 predicted 735
8 SASI_Mm01_00027155 predicted 1217
9 SASI_Mm02_00350169 predicted 1068
10 SASI_Mm02_00350170 predicted 1209
11 SASI_Mm01_00027152 predicted 485
12 SASI_Mm01_00027154 predicted 1543
13 SASI_Mm01_00027156 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005539
VALIDATED
INPP5A MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 40kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005539.3-1032s21c1
Sequence:GTACCGGGAAGTGGTGAAGCTCATATTTCTCGAGAAATATGAGCTTCACCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-1815s1c1
Sequence:CCGGCGTCTGTCTATGTGACATTAACTCGAGTTAATGTCACATAGACAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005539.2-1116s1c1
Sequence:CCGGCGGAAGGTTATGCTCCAGTTACTCGAGTAACTGGAGCATAACCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-764s1c1
Sequence:CCGGCGAGTGCAAATGGTCAAGAAACTCGAGTTTCTTGACCATTTGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-953s1c1
Sequence:CCGGGCGATTCGAGAAGGTTTCCTACTCGAGTAGGAAACCTTCTCGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-495s1c1
Sequence:CCGGGTGGACAAGTTCGTCAAAGAACTCGAGTTCTTTGACGAACTTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005539
VALIDATED
INPP5A MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 40kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005539.3-1032s21c1
Sequence:GTACCGGGAAGTGGTGAAGCTCATATTTCTCGAGAAATATGAGCTTCACCACTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-1815s1c1
Sequence:CCGGCGTCTGTCTATGTGACATTAACTCGAGTTAATGTCACATAGACAGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005539.2-1116s1c1
Sequence:CCGGCGGAAGGTTATGCTCCAGTTACTCGAGTAACTGGAGCATAACCTTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-764s1c1
Sequence:CCGGCGAGTGCAAATGGTCAAGAAACTCGAGTTTCTTGACCATTTGCACTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-953s1c1
Sequence:CCGGGCGATTCGAGAAGGTTTCCTACTCGAGTAGGAAACCTTCTCGAATCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-495s1c1
Sequence:CCGGGTGGACAAGTTCGTCAAAGAACTCGAGTTCTTTGACGAACTTGTCCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005539
VALIDATED
INPP5A MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 40kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005539.3-1032s21c1
Sequence:GTACCGGGAAGTGGTGAAGCTCATATTTCTCGAGAAATATGAGCTTCACCACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-1815s1c1
Sequence:CCGGCGTCTGTCTATGTGACATTAACTCGAGTTAATGTCACATAGACAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005539.2-1116s1c1
Sequence:CCGGCGGAAGGTTATGCTCCAGTTACTCGAGTAACTGGAGCATAACCTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-764s1c1
Sequence:CCGGCGAGTGCAAATGGTCAAGAAACTCGAGTTTCTTGACCATTTGCACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-953s1c1
Sequence:CCGGGCGATTCGAGAAGGTTTCCTACTCGAGTAGGAAACCTTCTCGAATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005539.2-495s1c1
Sequence:CCGGGTGGACAAGTTCGTCAAAGAACTCGAGTTCTTTGACGAACTTGTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183144
VALIDATED
INPP5A MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 40kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-670s21c1
Sequence:CCGGTCACTGGCAAGGAGATCTATTCTCGAGAATAGATCTCCTTGCCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-2025s21c1
Sequence:CCGGGCTGAATATACTTTCCAGTATCTCGAGATACTGGAAAGTATATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-810s21c1
Sequence:CCGGGCCTTCGACTTGGTGAACATTCTCGAGAATGTTCACCAAGTCGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-959s21c1
Sequence:CCGGCTACTTTGTCTTCGGTGATTTCTCGAGAAATCACCGAAGACAAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-1282s1c1
Sequence:CCGGCCAGGGAGAACAGTACATGAACTCGAGTTCATGTACTGTTCTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-2024s1c1
Sequence:CCGGGCTGAATATACTTTCCAGTATCTCGAGATACTGGAAAGTATATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-809s1c1
Sequence:CCGGGCCTTCGACTTGGTGAACATTCTCGAGAATGTTCACCAAGTCGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183144.1-478s1c1
Sequence:CCGGCCATGTGGACAAATTTGTCAACTCGAGTTGACAAATTTGTCCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183144.1-634s1c1
Sequence:CCGGCCAGTTTGACTTTAAAGCTAACTCGAGTTAGCTTTAAAGTCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183144.3-1398s21c1
Sequence:CCGGTACGACCACATCGGGCCTAATCTCGAGATTAGGCCCGATGTGGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183144
VALIDATED
INPP5A MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 40kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-670s21c1
Sequence:CCGGTCACTGGCAAGGAGATCTATTCTCGAGAATAGATCTCCTTGCCAGTGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000317119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-2025s21c1
Sequence:CCGGGCTGAATATACTTTCCAGTATCTCGAGATACTGGAAAGTATATTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-810s21c1
Sequence:CCGGGCCTTCGACTTGGTGAACATTCTCGAGAATGTTCACCAAGTCGAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-959s21c1
Sequence:CCGGCTACTTTGTCTTCGGTGATTTCTCGAGAAATCACCGAAGACAAAGTAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-1282s1c1
Sequence:CCGGCCAGGGAGAACAGTACATGAACTCGAGTTCATGTACTGTTCTCCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-2024s1c1
Sequence:CCGGGCTGAATATACTTTCCAGTATCTCGAGATACTGGAAAGTATATTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-809s1c1
Sequence:CCGGGCCTTCGACTTGGTGAACATTCTCGAGAATGTTCACCAAGTCGAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183144.1-478s1c1
Sequence:CCGGCCATGTGGACAAATTTGTCAACTCGAGTTGACAAATTTGTCCACATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183144.1-634s1c1
Sequence:CCGGCCAGTTTGACTTTAAAGCTAACTCGAGTTAGCTTTAAAGTCAAACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183144.3-1398s21c1
Sequence:CCGGTACGACCACATCGGGCCTAATCTCGAGATTAGGCCCGATGTGGTCGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183144
VALIDATED
INPP5A MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 40kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-670s21c1
Sequence:CCGGTCACTGGCAAGGAGATCTATTCTCGAGAATAGATCTCCTTGCCAGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-2025s21c1
Sequence:CCGGGCTGAATATACTTTCCAGTATCTCGAGATACTGGAAAGTATATTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-810s21c1
Sequence:CCGGGCCTTCGACTTGGTGAACATTCTCGAGAATGTTCACCAAGTCGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183144.3-959s21c1
Sequence:CCGGCTACTTTGTCTTCGGTGATTTCTCGAGAAATCACCGAAGACAAAGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-1282s1c1
Sequence:CCGGCCAGGGAGAACAGTACATGAACTCGAGTTCATGTACTGTTCTCCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-2024s1c1
Sequence:CCGGGCTGAATATACTTTCCAGTATCTCGAGATACTGGAAAGTATATTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183144.1-809s1c1
Sequence:CCGGGCCTTCGACTTGGTGAACATTCTCGAGAATGTTCACCAAGTCGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183144.1-478s1c1
Sequence:CCGGCCATGTGGACAAATTTGTCAACTCGAGTTGACAAATTTGTCCACATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183144.1-634s1c1
Sequence:CCGGCCAGTTTGACTTTAAAGCTAACTCGAGTTAGCTTTAAAGTCAAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183144.3-1398s21c1
Sequence:CCGGTACGACCACATCGGGCCTAATCTCGAGATTAGGCCCGATGTGGTCGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)