EMAIL THIS PAGE TO A FRIEND

INPP5B

inositol polyphosphate-5-phosphatase, 75kDa

185 Gene Product Result for
Synonyms: 5PTase
Gene ID:
Human(3633) Summary: Cellular calcium signaling is controlled by the production of inositol phosphates (IPs) by phospholipase C in response to extracellular signals. The IP signaling molecules are inactivated by a family of inositol polyphosphate-5-phosphatases (5-phosphatases). This gene encodes the type II 5-phosphatase. The protein is localized to the cytosol and mitochondria, and associates with membranes through an isoprenyl modification near the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(16330) inositol polyphosphate-5-phosphatase B
Rat(362590) inositol polyphosphate-5-phosphatase B
chicken(419609) inositol polyphosphate-5-phosphatase, 75kDa
dog(100686373) inositol polyphosphate-5-phosphatase, 75kDa
cow(538291) inositol polyphosphate-5-phosphatase, 75kDa
Horse(100054559) inositol polyphosphate-5-phosphatase, 75kDa
domestic cat(101092699) inositol polyphosphate-5-phosphatase, 75kDa
sheep(101119358) inositol polyphosphate-5-phosphatase, 75kDa
domestic guinea pig(100722491) inositol polyphosphate-5-phosphatase, 75kDa
naked mole-rat(101704216) inositol polyphosphate-5-phosphatase, 75kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005540 Rosetta Predictions human pricing
XM_001056372 Rosetta Predictions rat pricing
XM_342909 Rosetta Predictions rat pricing
NM_008385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339778 predicted 2265
2 SASI_Hs01_00095258 predicted 448
3 SASI_Hs01_00095259 predicted 2119
4 SASI_Hs01_00095260 predicted 1113
5 SASI_Hs01_00095263 predicted 1981
6 SASI_Hs02_00339779 predicted 2357
7 SASI_Hs01_00095265 predicted 1093
8 SASI_Hs01_00095266 predicted 589
9 SASI_Hs01_00095267 predicted 719
10 SASI_Hs02_00339780 predicted 2479
11 SASI_Hs01_00095261 predicted 2323
12 SASI_Hs01_00095262 predicted 1656
13 SASI_Hs01_00095264 predicted 2253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283075 predicted 312
2 SASI_Rn02_00283076 predicted 1168
3 SASI_Rn02_00283077 predicted 3095
4 SASI_Rn02_00283078 predicted 1271
5 SASI_Rn02_00283079 predicted 641
6 SASI_Rn02_00283080 predicted 718
7 SASI_Rn02_00283081 predicted 2694
8 SASI_Rn02_00283082 predicted 1868
9 SASI_Rn02_00283083 predicted 412
10 SASI_Rn02_00283084 predicted 2303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395011 predicted 319
2 SASI_Rn02_00395012 predicted 1165
3 SASI_Rn02_00395013 predicted 3100
4 SASI_Rn02_00395014 predicted 1278
5 SASI_Rn02_00395015 predicted 638
6 SASI_Rn02_00395016 predicted 720
7 SASI_Rn02_00395017 predicted 2700
8 SASI_Rn02_00395018 predicted 1871
9 SASI_Rn02_00395019 predicted 412
10 SASI_Rn02_00395020 predicted 2300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046537 predicted 1152
2 SASI_Mm01_00046538 predicted 391
3 SASI_Mm01_00046539 predicted 2961
4 SASI_Mm01_00046540 predicted 2207
5 SASI_Mm01_00046541 predicted 2372
6 SASI_Mm02_00313761 predicted 1933
7 SASI_Mm01_00046543 predicted 2682
8 SASI_Mm01_00046544 predicted 1419
9 SASI_Mm01_00046545 predicted 1841
10 SASI_Mm01_00046546 predicted 1853
11 SASI_Mm01_00046542 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005540
VALIDATED
INPP5B MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 75kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-780s21c1
Sequence:CCGGTGTCGGACAAGGCTCATATTTCTCGAGAAATATGAGCCTTGTCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-2245s1c1
Sequence:CCGGGCTAGCATATTTGGCAGCTTACTCGAGTAAGCTGCCAAATATGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005540.1-3471s1c1
Sequence:CCGGGCCCAGATAATGGCTCAATAACTCGAGTTATTGAGCCATTATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-863s1c1
Sequence:CCGGGCGGGAACATACAATGTAAATCTCGAGATTTACATTGTATGTTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-1788s1c1
Sequence:CCGGGCTCCCTGGATAAGATGGAAACTCGAGTTTCCATCTTATCCAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005540.1-1262s1c1
Sequence:CCGGGCAGCCCACATTGAAGAGTATCTCGAGATACTCTTCAATGTGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-729s21c1
Sequence:CCGGATAAATCCAAGTCCGAAATTACTCGAGTAATTTCGGACTTGGATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-2455s21c1
Sequence:CCGGGGATACTGGAATGATTGATAACTCGAGTTATCAATCATTCCAGTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005540
VALIDATED
INPP5B MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 75kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-780s21c1
Sequence:CCGGTGTCGGACAAGGCTCATATTTCTCGAGAAATATGAGCCTTGTCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-2245s1c1
Sequence:CCGGGCTAGCATATTTGGCAGCTTACTCGAGTAAGCTGCCAAATATGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005540.1-3471s1c1
Sequence:CCGGGCCCAGATAATGGCTCAATAACTCGAGTTATTGAGCCATTATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-863s1c1
Sequence:CCGGGCGGGAACATACAATGTAAATCTCGAGATTTACATTGTATGTTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-1788s1c1
Sequence:CCGGGCTCCCTGGATAAGATGGAAACTCGAGTTTCCATCTTATCCAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005540.1-1262s1c1
Sequence:CCGGGCAGCCCACATTGAAGAGTATCTCGAGATACTCTTCAATGTGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-729s21c1
Sequence:CCGGATAAATCCAAGTCCGAAATTACTCGAGTAATTTCGGACTTGGATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-2455s21c1
Sequence:CCGGGGATACTGGAATGATTGATAACTCGAGTTATCAATCATTCCAGTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005540
VALIDATED
INPP5B MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 75kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-780s21c1
Sequence:CCGGTGTCGGACAAGGCTCATATTTCTCGAGAAATATGAGCCTTGTCCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-2245s1c1
Sequence:CCGGGCTAGCATATTTGGCAGCTTACTCGAGTAAGCTGCCAAATATGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005540.1-3471s1c1
Sequence:CCGGGCCCAGATAATGGCTCAATAACTCGAGTTATTGAGCCATTATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-863s1c1
Sequence:CCGGGCGGGAACATACAATGTAAATCTCGAGATTTACATTGTATGTTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005540.1-1788s1c1
Sequence:CCGGGCTCCCTGGATAAGATGGAAACTCGAGTTTCCATCTTATCCAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005540.1-1262s1c1
Sequence:CCGGGCAGCCCACATTGAAGAGTATCTCGAGATACTCTTCAATGTGGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-729s21c1
Sequence:CCGGATAAATCCAAGTCCGAAATTACTCGAGTAATTTCGGACTTGGATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005540.2-2455s21c1
Sequence:CCGGGGATACTGGAATGATTGATAACTCGAGTTATCAATCATTCCAGTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008385
VALIDATED
INPP5B MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 75kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2679s21c1
Sequence:CCGGGGCCAGAGTTTGACCATATAACTCGAGTTATATGGTCAAACTCTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2967s21c1
Sequence:CCGGATATTCTAGCTAGCATATTTGCTCGAGCAAATATGCTAGCTAGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-447s1c1
Sequence:CCGGCCTTTGGTTCACACACCAGAACTCGAGTTCTGGTGTGTGAACCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008385.3-3522s1c1
Sequence:CCGGGCTTAGAGGTTCCTGGATAAACTCGAGTTTATCCAGGAACCTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008385.3-2175s1c1
Sequence:CCGGCCGAGTCCTTCACGATTCATACTCGAGTATGAATCGTGAAGGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-2461s1c1
Sequence:CCGGCGGATCTCCTATCCATACATTCTCGAGAATGTATGGATAGGAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-2176s1c1
Sequence:CCGGCGAGTCCTTCACGATTCATAACTCGAGTTATGAATCGTGAAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2175s21c1
Sequence:CCGGCCGAGTCCTTCACGATTCATACTCGAGTATGAATCGTGAAGGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-3522s21c1
Sequence:CCGGGCTTAGAGGTTCCTGGATAAACTCGAGTTTATCCAGGAACCTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2461s21c1
Sequence:CCGGCGGATCTCCTATCCATACATTCTCGAGAATGTATGGATAGGAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008385
VALIDATED
INPP5B MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 75kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2679s21c1
Sequence:CCGGGGCCAGAGTTTGACCATATAACTCGAGTTATATGGTCAAACTCTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2967s21c1
Sequence:CCGGATATTCTAGCTAGCATATTTGCTCGAGCAAATATGCTAGCTAGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-447s1c1
Sequence:CCGGCCTTTGGTTCACACACCAGAACTCGAGTTCTGGTGTGTGAACCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008385.3-3522s1c1
Sequence:CCGGGCTTAGAGGTTCCTGGATAAACTCGAGTTTATCCAGGAACCTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008385.3-2175s1c1
Sequence:CCGGCCGAGTCCTTCACGATTCATACTCGAGTATGAATCGTGAAGGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-2461s1c1
Sequence:CCGGCGGATCTCCTATCCATACATTCTCGAGAATGTATGGATAGGAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-2176s1c1
Sequence:CCGGCGAGTCCTTCACGATTCATAACTCGAGTTATGAATCGTGAAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2175s21c1
Sequence:CCGGCCGAGTCCTTCACGATTCATACTCGAGTATGAATCGTGAAGGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-3522s21c1
Sequence:CCGGGCTTAGAGGTTCCTGGATAAACTCGAGTTTATCCAGGAACCTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2461s21c1
Sequence:CCGGCGGATCTCCTATCCATACATTCTCGAGAATGTATGGATAGGAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008385
VALIDATED
INPP5B MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 75kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2679s21c1
Sequence:CCGGGGCCAGAGTTTGACCATATAACTCGAGTTATATGGTCAAACTCTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2967s21c1
Sequence:CCGGATATTCTAGCTAGCATATTTGCTCGAGCAAATATGCTAGCTAGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-447s1c1
Sequence:CCGGCCTTTGGTTCACACACCAGAACTCGAGTTCTGGTGTGTGAACCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008385.3-3522s1c1
Sequence:CCGGGCTTAGAGGTTCCTGGATAAACTCGAGTTTATCCAGGAACCTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008385.3-2175s1c1
Sequence:CCGGCCGAGTCCTTCACGATTCATACTCGAGTATGAATCGTGAAGGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-2461s1c1
Sequence:CCGGCGGATCTCCTATCCATACATTCTCGAGAATGTATGGATAGGAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008385.3-2176s1c1
Sequence:CCGGCGAGTCCTTCACGATTCATAACTCGAGTTATGAATCGTGAAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2175s21c1
Sequence:CCGGCCGAGTCCTTCACGATTCATACTCGAGTATGAATCGTGAAGGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-3522s21c1
Sequence:CCGGGCTTAGAGGTTCCTGGATAAACTCGAGTTTATCCAGGAACCTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008385.3-2461s21c1
Sequence:CCGGCGGATCTCCTATCCATACATTCTCGAGAATGTATGGATAGGAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)