EMAIL THIS PAGE TO A FRIEND

INPP5D

inositol polyphosphate-5-phosphatase, 145kDa

103 Gene Product Result for
Synonyms: SHIP SHIP-1 SHIP1 SIP-145 hp51CN
Gene ID:
Human(3635) Summary: This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. Overall, the protein functions as a negative regulator of myeliod cell proliferation and survival. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(16331) inositol polyphosphate-5-phosphatase D
Rat(54259) inositol polyphosphate-5-phosphatase D
domestic guinea pig(100722743) inositol polyphosphate-5-phosphatase, 145kDa
naked mole-rat(101711777) inositol polyphosphate-5-phosphatase, 145kDa
sheep(101112941) inositol polyphosphate-5-phosphatase, 145kDa
Zebrafish(559103) inositol polyphosphate-5-phosphatase, 145kDa
chicken(424745) inositol polyphosphate-5-phosphatase, 145kDa
cow(507329) inositol polyphosphate-5-phosphatase, 145kDa
Horse(100064896) inositol polyphosphate-5-phosphatase, 145kDa
domestic cat(101100500) inositol polyphosphate-5-phosphatase, 145kDa
dog(100688270) inositol polyphosphate-5-phosphatase, 145kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005541 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070301 MISSION® esiRNA esiRNA human INPP5D (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
ABS10 Anti-SHIP Antibody Anti-SHIP Antibody detects level of SHIP & has been published & validated for use in WB & IP. pricing
05-1911 Anti-SHIP Antibody, clone P1C1 This SHIP antibody is validated for use in WB, ICC & IP for the detection of the SHIP protein. pricing
ABN1346 Anti-SHIP1 Antibody This Anti-SHIP1 Antibody is validated for use in Western Blotting, Immunohistochemistry for the detection of SHIP1. pricing
MABF143A Anti-TER-119 (mouse), APC, clone TER-119 Antibody This rat monoclonal Anti-TER-119 Antibody (mouse), APC, clone TER-119 Antibody, Cat. No. MABF1430 is validated for use in Flow Cytometry, for the detection of TER-119. pricing
MABF143B Anti-TER-119 (mouse), clone TER-119, biotin conjugate Antibody Anti-TER-119 (mouse), clone TER-119, biotin conjugate Antibody is an antibody against TER-119 for use in Flow Cytometry. pricing
MABF143C Anti-TER-119 (mouse), FITC, clone TER-119 Antibody Anti-TER-119 (mouse), FITC, clone TER-119 Antibody is an antibody against TER-119 for use in Flow Cytometry. pricing
MABF143D Anti-TER-119 (mouse), PE, clone TER-119 Antibody Anti-TER-119 (mouse), PE, clone TER-119 Antibody is an antibody against TER-119 for use in Flow Cytometry. pricing
MABF144A Anti-TER-119 (mouse), redFluor™ 710, clone TER-119 Antibody This rat monoclonal Anti-TER-119 Antibody (mouse), redFluor™ 710, clone TER-119 Antibody, Cat. No. MABF1441 is validated for use in Flow Cytometry, for the detection of TER-119. pricing
MABF143E Anti-TER-119 (mouse), violetFluor™ 450, clone TER-119 Antibody This rat monoclonal Anti-TER-119 Antibody (mouse), violetFluor™ 450, clone TER-119 Antibody, Cat. No. MABF1439 is validated for use in Flow Cytometry, for the detection of TER-119. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017915 Rosetta Predictions human pricing
NM_005541 Rosetta Predictions human pricing
NM_019311 Rosetta Predictions rat pricing
NM_001110192 Rosetta Predictions mouse pricing
NM_001110193 Rosetta Predictions mouse pricing
NM_010566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138094 predicted 702
2 SASI_Hs01_00138095 predicted 1539
3 SASI_Hs01_00138096 predicted 1116
4 SASI_Hs01_00138097 predicted 1680
5 SASI_Hs01_00138099 predicted 1091
6 SASI_Hs01_00138100 predicted 2120
7 SASI_Hs01_00138101 predicted 2315
8 SASI_Hs01_00138102 predicted 949
9 SASI_Hs01_00138103 predicted 2101
10 SASI_Hs02_00306798 predicted 1557
11 SASI_Hs01_00138098 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062805 predicted 1535
2 SASI_Hs01_00062806 predicted 1111
3 SASI_Hs01_00062807 predicted 1673
4 SASI_Hs01_00062809 predicted 1092
5 SASI_Hs01_00062810 predicted 2116
6 SASI_Hs01_00062811 predicted 2311
7 SASI_Hs01_00062812 predicted 942
8 SASI_Hs01_00062813 predicted 2096
9 SASI_Hs01_00062814 predicted 1548
10 SASI_Hs02_00339781 predicted 3053
11 SASI_Hs01_00062808 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096573 predicted 736
2 SASI_Rn01_00096574 predicted 2725
3 SASI_Rn01_00096575 predicted 2779
4 SASI_Rn01_00096576 predicted 360
5 SASI_Rn01_00096577 predicted 1608
6 SASI_Rn02_00262277 predicted 1403
7 SASI_Rn01_00096578 predicted 2905
8 SASI_Rn01_00096579 predicted 2312
9 SASI_Rn01_00096580 predicted 2277
10 SASI_Rn01_00096582 predicted 341
11 SASI_Rn01_00096581 predicted 2185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304826 predicted 2700
2 SASI_Mm02_00304827 predicted 3438
3 SASI_Mm02_00304828 predicted 1589
4 SASI_Mm02_00304829 predicted 2591
5 SASI_Mm02_00304830 predicted 2582
6 SASI_Mm02_00304831 predicted 1386
7 SASI_Mm02_00304832 predicted 2259
8 SASI_Mm02_00304833 predicted 3537
9 SASI_Mm02_00304834 predicted 2337
10 SASI_Mm02_00304835 predicted 2565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304836 predicted 2701
2 SASI_Mm02_00304837 predicted 3251
3 SASI_Mm02_00304838 predicted 1587
4 SASI_Mm02_00304839 predicted 2600
5 SASI_Mm02_00304840 predicted 2581
6 SASI_Mm02_00304841 predicted 1383
7 SASI_Mm02_00304842 predicted 2259
8 SASI_Mm02_00304843 predicted 3349
9 SASI_Mm02_00304844 predicted 2335
10 SASI_Mm02_00304845 predicted 2568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154204 predicted 2707
2 SASI_Mm01_00154206 predicted 3442
3 SASI_Mm01_00154207 predicted 1595
4 SASI_Mm01_00154208 predicted 2597
5 SASI_Mm01_00154209 predicted 2582
6 SASI_Mm01_00154210 predicted 1381
7 SASI_Mm01_00154211 predicted 2258
8 SASI_Mm01_00154212 predicted 3538
9 SASI_Mm01_00154213 predicted 2340
10 SASI_Mm02_00318843 predicted 2562
11 SASI_Mm01_00154205 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010566
INPP5D MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 145kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2206s21c1
Sequence:CCGGCGAGTCCTCTGGAAGTCTTACCTCGAGGTAAGACTTCCAGAGGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-1887s21c1
Sequence:CCGGCAAGAAGCTAAGCCCATTTAACTCGAGTTAAATGGGCTTAGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2586s21c1
Sequence:CCGGGCATATCCTGATCAGCATTAACTCGAGTTAATGCTGATCAGGATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-325s21c1
Sequence:CCGGCGGAATTGTGTTTACACTTACCTCGAGGTAAGTGTAAACACAATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2529s21c1
Sequence:CCGGAGAGACTCTTCCCAAGCTAAACTCGAGTTTAGCTTGGGAAGAGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010566.1-4020s1c1
Sequence:CCGGCCGAGGGTGAAGATATAAATACTCGAGTATTTATATCTTCACCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-2239s1c1
Sequence:CCGGCGTTTGAAGCAGGAGTCACATCTCGAGATGTGACTCCTGCTTCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-2934s1c1
Sequence:CCGGGCTTGGAGTTATGACCAGCTACTCGAGTAGCTGGTCATAACTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-1157s1c1
Sequence:CCGGGCTCATTAAGTCCCAGAAGTTCTCGAGAACTTCTGGGACTTAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010566
INPP5D MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 145kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2206s21c1
Sequence:CCGGCGAGTCCTCTGGAAGTCTTACCTCGAGGTAAGACTTCCAGAGGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-1887s21c1
Sequence:CCGGCAAGAAGCTAAGCCCATTTAACTCGAGTTAAATGGGCTTAGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2586s21c1
Sequence:CCGGGCATATCCTGATCAGCATTAACTCGAGTTAATGCTGATCAGGATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-325s21c1
Sequence:CCGGCGGAATTGTGTTTACACTTACCTCGAGGTAAGTGTAAACACAATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2529s21c1
Sequence:CCGGAGAGACTCTTCCCAAGCTAAACTCGAGTTTAGCTTGGGAAGAGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010566.1-4020s1c1
Sequence:CCGGCCGAGGGTGAAGATATAAATACTCGAGTATTTATATCTTCACCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-2239s1c1
Sequence:CCGGCGTTTGAAGCAGGAGTCACATCTCGAGATGTGACTCCTGCTTCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-2934s1c1
Sequence:CCGGGCTTGGAGTTATGACCAGCTACTCGAGTAGCTGGTCATAACTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-1157s1c1
Sequence:CCGGGCTCATTAAGTCCCAGAAGTTCTCGAGAACTTCTGGGACTTAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010566
INPP5D MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 145kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2206s21c1
Sequence:CCGGCGAGTCCTCTGGAAGTCTTACCTCGAGGTAAGACTTCCAGAGGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-1887s21c1
Sequence:CCGGCAAGAAGCTAAGCCCATTTAACTCGAGTTAAATGGGCTTAGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2586s21c1
Sequence:CCGGGCATATCCTGATCAGCATTAACTCGAGTTAATGCTGATCAGGATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-325s21c1
Sequence:CCGGCGGAATTGTGTTTACACTTACCTCGAGGTAAGTGTAAACACAATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010566.2-2529s21c1
Sequence:CCGGAGAGACTCTTCCCAAGCTAAACTCGAGTTTAGCTTGGGAAGAGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010566.1-4020s1c1
Sequence:CCGGCCGAGGGTGAAGATATAAATACTCGAGTATTTATATCTTCACCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-2239s1c1
Sequence:CCGGCGTTTGAAGCAGGAGTCACATCTCGAGATGTGACTCCTGCTTCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-2934s1c1
Sequence:CCGGGCTTGGAGTTATGACCAGCTACTCGAGTAGCTGGTCATAACTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010566.1-1157s1c1
Sequence:CCGGGCTCATTAAGTCCCAGAAGTTCTCGAGAACTTCTGGGACTTAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005541
INPP5D MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 145kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-3878s1c1
Sequence:CCGGGCCTTCCAGATCGGAAATCAACTCGAGTTGATTTCCGATCTGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-1547s1c1
Sequence:CCGGGCTCATTAAGTCACAGAAATTCTCGAGAATTTCTGTGACTTAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-2387s1c1
Sequence:CCGGGCAGAAGGTCTTCCTACACTTCTCGAGAAGTGTAGGAAGACCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-3413s1c1
Sequence:CCGGGCCCATATCACCCAAGAAGTTCTCGAGAACTTCTTGGGTGATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005541.2-4480s1c1
Sequence:CCGGGCTAAGTGCTTTACGAACATTCTCGAGAATGTTCGTAAAGCACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010362    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_005541.x-281s1c1
Sequence:CCGGAATTGCGTTTACACTTACAGCTCGAGCTGTAAGTGTAAACGCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.x-2327s1c1
Sequence:CCGGATTGAGTTTCTCAGGTGCTACTCGAGTAGCACCTGAGAAACTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005541
INPP5D MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 145kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-3878s1c1
Sequence:CCGGGCCTTCCAGATCGGAAATCAACTCGAGTTGATTTCCGATCTGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-1547s1c1
Sequence:CCGGGCTCATTAAGTCACAGAAATTCTCGAGAATTTCTGTGACTTAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-2387s1c1
Sequence:CCGGGCAGAAGGTCTTCCTACACTTCTCGAGAAGTGTAGGAAGACCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-3413s1c1
Sequence:CCGGGCCCATATCACCCAAGAAGTTCTCGAGAACTTCTTGGGTGATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005541.2-4480s1c1
Sequence:CCGGGCTAAGTGCTTTACGAACATTCTCGAGAATGTTCGTAAAGCACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010362    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_005541.x-281s1c1
Sequence:CCGGAATTGCGTTTACACTTACAGCTCGAGCTGTAAGTGTAAACGCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.x-2327s1c1
Sequence:CCGGATTGAGTTTCTCAGGTGCTACTCGAGTAGCACCTGAGAAACTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005541
INPP5D MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 145kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-3878s1c1
Sequence:CCGGGCCTTCCAGATCGGAAATCAACTCGAGTTGATTTCCGATCTGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-1547s1c1
Sequence:CCGGGCTCATTAAGTCACAGAAATTCTCGAGAATTTCTGTGACTTAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-2387s1c1
Sequence:CCGGGCAGAAGGTCTTCCTACACTTCTCGAGAAGTGTAGGAAGACCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.2-3413s1c1
Sequence:CCGGGCCCATATCACCCAAGAAGTTCTCGAGAACTTCTTGGGTGATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005541.2-4480s1c1
Sequence:CCGGGCTAAGTGCTTTACGAACATTCTCGAGAATGTTCGTAAAGCACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010362    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_005541.x-281s1c1
Sequence:CCGGAATTGCGTTTACACTTACAGCTCGAGCTGTAAGTGTAAACGCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005541.x-2327s1c1
Sequence:CCGGATTGAGTTTCTCAGGTGCTACTCGAGTAGCACCTGAGAAACTCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)