EMAIL THIS PAGE TO A FRIEND

INPP5E

inositol polyphosphate-5-phosphatase, 72 kDa

66 Gene Product Result for
Synonyms: CORS1 CPD4 JBTS1 MORMS PPI5PIV
UniProtKB ID: Q9NRR6, Q15734, Q6PIV5
Gene ID:
Human(56623) Summary: The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly.[provided by RefSeq, Feb 2011]
Mouse(64436) inositol polyphosphate-5-phosphatase E
Rat(114089) inositol polyphosphate-5-phosphatase E
Zebrafish(606579) inositol polyphosphate-5-phosphatase
cow(506349) inositol polyphosphate-5-phosphatase, 72 kDa
domestic cat(101093901) inositol polyphosphate-5-phosphatase, 72 kDa
dog(607443) inositol polyphosphate-5-phosphatase, 72 kDa
chicken(417135) inositol polyphosphate-5-phosphatase, 72 kDa
sheep(101115530) inositol polyphosphate-5-phosphatase, 72 kDa
domestic guinea pig(100715053) inositol polyphosphate-5-phosphatase, 72 kDa
naked mole-rat(101701719) inositol polyphosphate-5-phosphatase, 72 kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019892 Rosetta Predictions human pricing
XM_001078406 Rosetta Predictions rat pricing
XM_342391 Rosetta Predictions rat pricing
NM_033134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080655 predicted 2065
2 SASI_Hs01_00080656 predicted 1258
3 SASI_Hs01_00080657 predicted 1517
4 SASI_Hs01_00080658 predicted 1402
5 SASI_Hs01_00080659 predicted 2022
6 SASI_Hs01_00080660 predicted 1906
7 SASI_Hs01_00080661 predicted 1922
8 SASI_Hs01_00080662 predicted 1564
9 SASI_Hs01_00080663 predicted 1004
10 SASI_Hs02_00352906 predicted 1490
11 SASI_Hs01_00080664 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360664 predicted 5327
2 SASI_Rn02_00360665 predicted 1589
3 SASI_Rn02_00360666 predicted 666
4 SASI_Rn02_00360667 predicted 5253
5 SASI_Rn02_00360668 predicted 3056
6 SASI_Rn02_00360669 predicted 2389
7 SASI_Rn02_00360670 predicted 3754
8 SASI_Rn02_00360671 predicted 5373
9 SASI_Rn02_00360672 predicted 4611
10 SASI_Rn02_00360673 predicted 3647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394207 predicted 2450
2 SASI_Rn02_00394208 predicted 3448
3 SASI_Rn02_00394209 predicted 328
4 SASI_Rn02_00394210 predicted 1243
5 SASI_Rn02_00394211 predicted 2375
6 SASI_Rn02_00394212 predicted 2032
7 SASI_Rn02_00394213 predicted 873
8 SASI_Rn02_00394214 predicted 2487
9 SASI_Rn02_00394215 predicted 1732
10 SASI_Rn02_00394216 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081701 predicted 2037
2 SASI_Mm01_00081702 predicted 1715
3 SASI_Mm01_00081703 predicted 2613
4 SASI_Mm01_00081704 predicted 1601
5 SASI_Mm01_00081705 predicted 1196
6 SASI_Mm01_00081707 predicted 2303
7 SASI_Mm01_00081709 predicted 2253
8 SASI_Mm01_00081710 predicted 2347
9 SASI_Mm02_00337290 predicted 2262
10 SASI_Mm02_00337291 predicted 1767
11 SASI_Mm01_00081706 predicted 2621
12 SASI_Mm01_00081708 predicted 1418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019892
VALIDATED
INPP5E MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 72 kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-1978s1c1
Sequence:CCGGCCCATCATACAAGTTTGACATCTCGAGATGTCAAACTTGTATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019892.3-2272s1c1
Sequence:CCGGGCAAGCACTACAGAGTCAGAACTCGAGTTCTGACTCTGTAGTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-1576s1c1
Sequence:CCGGCGTGTCTCAGATCAAGACCAACTCGAGTTGGTCTTGATCTGAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-3217s1c1
Sequence:CCGGCGAGAGTATAGAACCGTTCATCTCGAGATGAACGGTTCTATACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-2201s1c1
Sequence:CCGGGCTGGCAAATTTGATAGAGAACTCGAGTTCTCTATCAAATTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019892.3-1974s21c1
Sequence:CCGGTCCTCCCATCATACAAGTTTGCTCGAGCAAACTTGTATGATGGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019892.3-2306s21c1
Sequence:CCGGTGCTCCGTTTCTTGAAGTTTGCTCGAGCAAACTTCAAGAAACGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019892.3-2191s21c1
Sequence:CCGGTCCGTTGGCAGCTGGCAAATTCTCGAGAATTTGCCAGCTGCCAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019892
VALIDATED
INPP5E MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 72 kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-1978s1c1
Sequence:CCGGCCCATCATACAAGTTTGACATCTCGAGATGTCAAACTTGTATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019892.3-2272s1c1
Sequence:CCGGGCAAGCACTACAGAGTCAGAACTCGAGTTCTGACTCTGTAGTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-1576s1c1
Sequence:CCGGCGTGTCTCAGATCAAGACCAACTCGAGTTGGTCTTGATCTGAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-3217s1c1
Sequence:CCGGCGAGAGTATAGAACCGTTCATCTCGAGATGAACGGTTCTATACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-2201s1c1
Sequence:CCGGGCTGGCAAATTTGATAGAGAACTCGAGTTCTCTATCAAATTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019892.3-1974s21c1
Sequence:CCGGTCCTCCCATCATACAAGTTTGCTCGAGCAAACTTGTATGATGGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019892.3-2306s21c1
Sequence:CCGGTGCTCCGTTTCTTGAAGTTTGCTCGAGCAAACTTCAAGAAACGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019892.3-2191s21c1
Sequence:CCGGTCCGTTGGCAGCTGGCAAATTCTCGAGAATTTGCCAGCTGCCAACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019892
VALIDATED
INPP5E MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 72 kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-1978s1c1
Sequence:CCGGCCCATCATACAAGTTTGACATCTCGAGATGTCAAACTTGTATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019892.3-2272s1c1
Sequence:CCGGGCAAGCACTACAGAGTCAGAACTCGAGTTCTGACTCTGTAGTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-1576s1c1
Sequence:CCGGCGTGTCTCAGATCAAGACCAACTCGAGTTGGTCTTGATCTGAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-3217s1c1
Sequence:CCGGCGAGAGTATAGAACCGTTCATCTCGAGATGAACGGTTCTATACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_019892.3-2201s1c1
Sequence:CCGGGCTGGCAAATTTGATAGAGAACTCGAGTTCTCTATCAAATTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019892.3-1974s21c1
Sequence:CCGGTCCTCCCATCATACAAGTTTGCTCGAGCAAACTTGTATGATGGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_019892.3-2306s21c1
Sequence:CCGGTGCTCCGTTTCTTGAAGTTTGCTCGAGCAAACTTCAAGAAACGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019892.3-2191s21c1
Sequence:CCGGTCCGTTGGCAGCTGGCAAATTCTCGAGAATTTGCCAGCTGCCAACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033134
VALIDATED
INPP5E MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase, 72 kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033134.2-3959s1c1
Sequence:CCGGGCCCAAGATCAAGATCATAAACTCGAGTTTATGATCTTGATCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033134.2-2428s1c1
Sequence:CCGGCGGCAAGTTTGACCGAGAATTCTCGAGAATTCTCGGTCAAACTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033134.2-1077s1c1
Sequence:CCGGCCTTGTGGAGTGACTGTCTTTCTCGAGAAAGACAGTCACTCCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033134.2-796s1c1
Sequence:CCGGGAACCCACAAACTAAGGCAAACTCGAGTTTGCCTTAGTTTGTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033134.2-2204s1c1
Sequence:CCGGCCATCCTACAAGTTTGACATTCTCGAGAATGTCAAACTTGTAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-3045s21c1
Sequence:CCGGCAGGCCAAGCCTAGCTATATTCTCGAGAATATAGCTAGGCTTGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2310s21c1
Sequence:CCGGACATCTGTCCCATGAAGTATTCTCGAGAATACTTCATGGGACAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2269s21c1
Sequence:CCGGCTACACAGACCGAGTCCTATACTCGAGTATAGGACTCGGTCTGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033134.2-1361s21c1
Sequence:CCGGATTCACTCAGCCAGATCTTTCCTCGAGGAAAGATCTGGCTGAGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2428s21c1
Sequence:CCGGCGGCAAGTTTGACCGAGAATTCTCGAGAATTCTCGGTCAAACTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033134
VALIDATED
INPP5E MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase, 72 kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033134.2-3959s1c1
Sequence:CCGGGCCCAAGATCAAGATCATAAACTCGAGTTTATGATCTTGATCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033134.2-2428s1c1
Sequence:CCGGCGGCAAGTTTGACCGAGAATTCTCGAGAATTCTCGGTCAAACTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033134.2-1077s1c1
Sequence:CCGGCCTTGTGGAGTGACTGTCTTTCTCGAGAAAGACAGTCACTCCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033134.2-796s1c1
Sequence:CCGGGAACCCACAAACTAAGGCAAACTCGAGTTTGCCTTAGTTTGTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033134.2-2204s1c1
Sequence:CCGGCCATCCTACAAGTTTGACATTCTCGAGAATGTCAAACTTGTAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-3045s21c1
Sequence:CCGGCAGGCCAAGCCTAGCTATATTCTCGAGAATATAGCTAGGCTTGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2310s21c1
Sequence:CCGGACATCTGTCCCATGAAGTATTCTCGAGAATACTTCATGGGACAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2269s21c1
Sequence:CCGGCTACACAGACCGAGTCCTATACTCGAGTATAGGACTCGGTCTGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033134.2-1361s21c1
Sequence:CCGGATTCACTCAGCCAGATCTTTCCTCGAGGAAAGATCTGGCTGAGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2428s21c1
Sequence:CCGGCGGCAAGTTTGACCGAGAATTCTCGAGAATTCTCGGTCAAACTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033134
VALIDATED
INPP5E MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase, 72 kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033134.2-3959s1c1
Sequence:CCGGGCCCAAGATCAAGATCATAAACTCGAGTTTATGATCTTGATCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033134.2-2428s1c1
Sequence:CCGGCGGCAAGTTTGACCGAGAATTCTCGAGAATTCTCGGTCAAACTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033134.2-1077s1c1
Sequence:CCGGCCTTGTGGAGTGACTGTCTTTCTCGAGAAAGACAGTCACTCCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033134.2-796s1c1
Sequence:CCGGGAACCCACAAACTAAGGCAAACTCGAGTTTGCCTTAGTTTGTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033134.2-2204s1c1
Sequence:CCGGCCATCCTACAAGTTTGACATTCTCGAGAATGTCAAACTTGTAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-3045s21c1
Sequence:CCGGCAGGCCAAGCCTAGCTATATTCTCGAGAATATAGCTAGGCTTGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2310s21c1
Sequence:CCGGACATCTGTCCCATGAAGTATTCTCGAGAATACTTCATGGGACAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2269s21c1
Sequence:CCGGCTACACAGACCGAGTCCTATACTCGAGTATAGGACTCGGTCTGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033134.2-1361s21c1
Sequence:CCGGATTCACTCAGCCAGATCTTTCCTCGAGGAAAGATCTGGCTGAGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033134.2-2428s21c1
Sequence:CCGGCGGCAAGTTTGACCGAGAATTCTCGAGAATTCTCGGTCAAACTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)