EMAIL THIS PAGE TO A FRIEND

INPP5J

inositol polyphosphate-5-phosphatase J

144 Gene Product Result for
Synonyms: INPP5 PIB5PA PIPP
UniProtKB ID: Q15735, B3KS54, Q32M61, Q6ZTH6, Q8N902, Q9UDT9
Gene ID:
Mouse(170835) inositol polyphosphate 5-phosphatase J
Rat(171088) inositol polyphosphate-5-phosphatase J
chicken(416996) inositol polyphosphate-5-phosphatase J
domestic cat(101095688) inositol polyphosphate-5-phosphatase J
cow(514307) inositol polyphosphate-5-phosphatase J
Horse(100058547) inositol polyphosphate-5-phosphatase J
dog(486360) inositol polyphosphate-5-phosphatase J
sheep(101103674) inositol polyphosphate-5-phosphatase J
domestic guinea pig(100731968) inositol polyphosphate-5-phosphatase J
naked mole-rat(101726724) inositol polyphosphate-5-phosphatase J
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002837 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002837 Rosetta Predictions human pricing
NM_014422 Rosetta Predictions human pricing
NM_133562 Rosetta Predictions rat pricing
NM_172439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304217 predicted 298
2 SASI_Hs02_00304218 predicted 327
3 SASI_Hs02_00304219 predicted 1984
4 SASI_Hs01_00059844 predicted 1381
5 SASI_Hs01_00059847 predicted 1327
6 SASI_Hs01_00059848 predicted 1286
7 SASI_Hs01_00059850 predicted 841
8 SASI_Hs01_00059851 predicted 1254
9 SASI_Hs02_00304220 predicted 977
10 SASI_Hs02_00304221 predicted 757
11 SASI_Hs01_00059845 predicted 1709
12 SASI_Hs01_00059846 predicted 1419
13 SASI_Hs01_00059849 predicted 802
14 SASI_Hs01_00059852 predicted 742
15 SASI_Hs01_00059853 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240916 predicted 1560
2 SASI_Hs01_00240917 predicted 1890
3 SASI_Hs01_00240918 predicted 1598
4 SASI_Hs01_00240919 predicted 1507
5 SASI_Hs01_00240920 predicted 1472
6 SASI_Hs01_00240921 predicted 983
7 SASI_Hs01_00240922 predicted 1026
8 SASI_Hs01_00240923 predicted 1439
9 SASI_Hs01_00240924 predicted 919
10 SASI_Hs01_00240925 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095480 predicted 1386
2 SASI_Rn01_00095481 predicted 1934
3 SASI_Rn01_00095482 predicted 1416
4 SASI_Rn01_00095483 predicted 381
5 SASI_Rn01_00095484 predicted 1734
6 SASI_Rn01_00095485 predicted 2013
7 SASI_Rn01_00095486 predicted 2376
8 SASI_Rn01_00095487 predicted 2068
9 SASI_Rn01_00095488 predicted 3074
10 SASI_Rn02_00267757 predicted 1847
11 SASI_Rn01_00095479 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116780 predicted 1889
2 SASI_Mm01_00116782 predicted 2505
3 SASI_Mm01_00116783 predicted 2410
4 SASI_Mm02_00343927 predicted 759
5 SASI_Mm01_00116784 predicted 1903
6 SASI_Mm01_00116785 predicted 1887
7 SASI_Mm01_00116786 predicted 1429
8 SASI_Mm01_00116787 predicted 1773
9 SASI_Mm01_00116788 predicted 1970
10 SASI_Mm01_00116789 predicted 2101
11 SASI_Mm01_00116781 predicted 1837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002837
VALIDATED
INPP5J MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase J
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1275s21c1
Sequence:CCGGTCCGCCATTGCAAGGACTATGCTCGAGCATAGTCCTTGCAATGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-1987s1c1
Sequence:CCGGCCACCATTCTGCCTCAATCTTCTCGAGAAGATTGAGGCAGAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002837.1-906s1c1
Sequence:CCGGCCTTCAAGTTTGATGTGGGTACTCGAGTACCCACATCAAACTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-340s1c1
Sequence:CCGGCATGCTCAACAAGCGACTCAACTCGAGTTGAGTCGCTTGTTGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-1393s1c1
Sequence:CCGGCCTGGGCTACTATAGTCACAACTCGAGTTGTGACTATAGTAGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002837.1-775s1c1
Sequence:CCGGGCACTTTGTCAAGTTTGCCATCTCGAGATGGCAAACTTGACAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1244s21c1
Sequence:CCGGTGGGACTGGATCGGCTTATACCTCGAGGTATAAGCCGATCCAGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002837.1-1987s21c1
Sequence:CCGGCCACCATTCTGCCTCAATCTTCTCGAGAAGATTGAGGCAGAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002837.1-1393s21c1
Sequence:CCGGCCTGGGCTACTATAGTCACAACTCGAGTTGTGACTATAGTAGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-771s21c1
Sequence:GTACCGGACCTGCACTTTGTCAAGTTTGCTCGAGCAAACTTGACAAAGTGCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1317s21c1
Sequence:GTACCGGATGAAGATGTGGATGGGAATACTCGAGTATTCCCATCCACATCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-936s21c1
Sequence:CCGGACGATACCAGTGCCAAGAAACCTCGAGGTTTCTTGGCACTGGTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002837
VALIDATED
INPP5J MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase J
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1275s21c1
Sequence:CCGGTCCGCCATTGCAAGGACTATGCTCGAGCATAGTCCTTGCAATGGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-1987s1c1
Sequence:CCGGCCACCATTCTGCCTCAATCTTCTCGAGAAGATTGAGGCAGAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002837.1-906s1c1
Sequence:CCGGCCTTCAAGTTTGATGTGGGTACTCGAGTACCCACATCAAACTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-340s1c1
Sequence:CCGGCATGCTCAACAAGCGACTCAACTCGAGTTGAGTCGCTTGTTGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-1393s1c1
Sequence:CCGGCCTGGGCTACTATAGTCACAACTCGAGTTGTGACTATAGTAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002837.1-775s1c1
Sequence:CCGGGCACTTTGTCAAGTTTGCCATCTCGAGATGGCAAACTTGACAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1244s21c1
Sequence:CCGGTGGGACTGGATCGGCTTATACCTCGAGGTATAAGCCGATCCAGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002837.1-1987s21c1
Sequence:CCGGCCACCATTCTGCCTCAATCTTCTCGAGAAGATTGAGGCAGAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002837.1-1393s21c1
Sequence:CCGGCCTGGGCTACTATAGTCACAACTCGAGTTGTGACTATAGTAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-771s21c1
Sequence:GTACCGGACCTGCACTTTGTCAAGTTTGCTCGAGCAAACTTGACAAAGTGCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1317s21c1
Sequence:GTACCGGATGAAGATGTGGATGGGAATACTCGAGTATTCCCATCCACATCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-936s21c1
Sequence:CCGGACGATACCAGTGCCAAGAAACCTCGAGGTTTCTTGGCACTGGTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002837
VALIDATED
INPP5J MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase J
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1275s21c1
Sequence:CCGGTCCGCCATTGCAAGGACTATGCTCGAGCATAGTCCTTGCAATGGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-1987s1c1
Sequence:CCGGCCACCATTCTGCCTCAATCTTCTCGAGAAGATTGAGGCAGAATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002837.1-906s1c1
Sequence:CCGGCCTTCAAGTTTGATGTGGGTACTCGAGTACCCACATCAAACTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-340s1c1
Sequence:CCGGCATGCTCAACAAGCGACTCAACTCGAGTTGAGTCGCTTGTTGAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001002837.1-1393s1c1
Sequence:CCGGCCTGGGCTACTATAGTCACAACTCGAGTTGTGACTATAGTAGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002837.1-775s1c1
Sequence:CCGGGCACTTTGTCAAGTTTGCCATCTCGAGATGGCAAACTTGACAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1244s21c1
Sequence:CCGGTGGGACTGGATCGGCTTATACCTCGAGGTATAAGCCGATCCAGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002837.1-1987s21c1
Sequence:CCGGCCACCATTCTGCCTCAATCTTCTCGAGAAGATTGAGGCAGAATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002837.1-1393s21c1
Sequence:CCGGCCTGGGCTACTATAGTCACAACTCGAGTTGTGACTATAGTAGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-771s21c1
Sequence:GTACCGGACCTGCACTTTGTCAAGTTTGCTCGAGCAAACTTGACAAAGTGCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-1317s21c1
Sequence:GTACCGGATGAAGATGTGGATGGGAATACTCGAGTATTCCCATCCACATCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001002837.1-936s21c1
Sequence:CCGGACGATACCAGTGCCAAGAAACCTCGAGGTTTCTTGGCACTGGTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172439
VALIDATED
INPP5J MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase J
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172439.1-3109s1c1
Sequence:CCGGCAGTCTCATTCTGCCTATCTTCTCGAGAAGATAGGCAGAATGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-547s1c1
Sequence:CCGGCCGTCCTAACTCCAACTTCTACTCGAGTAGAAGTTGGAGTTAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-2017s1c1
Sequence:CCGGCCCTTAACTTTGCTCCCACTTCTCGAGAAGTGGGAGCAAAGTTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-2241s1c1
Sequence:CCGGGCCCAGTTCATTCTGCAGTTTCTCGAGAAACTGCAGAATGAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172439.1-2510s1c1
Sequence:CCGGCGGAGACTTCATTCTGGGTTACTCGAGTAACCCAGAATGAAGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172439.3-3250s21c1
Sequence:CCGGCAACTGTGACAATCAGCAAAGCTCGAGCTTTGCTGATTGTCACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172439
VALIDATED
INPP5J MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase J
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172439.1-3109s1c1
Sequence:CCGGCAGTCTCATTCTGCCTATCTTCTCGAGAAGATAGGCAGAATGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-547s1c1
Sequence:CCGGCCGTCCTAACTCCAACTTCTACTCGAGTAGAAGTTGGAGTTAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-2017s1c1
Sequence:CCGGCCCTTAACTTTGCTCCCACTTCTCGAGAAGTGGGAGCAAAGTTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-2241s1c1
Sequence:CCGGGCCCAGTTCATTCTGCAGTTTCTCGAGAAACTGCAGAATGAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172439.1-2510s1c1
Sequence:CCGGCGGAGACTTCATTCTGGGTTACTCGAGTAACCCAGAATGAAGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172439.3-3250s21c1
Sequence:CCGGCAACTGTGACAATCAGCAAAGCTCGAGCTTTGCTGATTGTCACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172439
VALIDATED
INPP5J MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase J
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172439.1-3109s1c1
Sequence:CCGGCAGTCTCATTCTGCCTATCTTCTCGAGAAGATAGGCAGAATGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-547s1c1
Sequence:CCGGCCGTCCTAACTCCAACTTCTACTCGAGTAGAAGTTGGAGTTAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-2017s1c1
Sequence:CCGGCCCTTAACTTTGCTCCCACTTCTCGAGAAGTGGGAGCAAAGTTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172439.1-2241s1c1
Sequence:CCGGGCCCAGTTCATTCTGCAGTTTCTCGAGAAACTGCAGAATGAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172439.1-2510s1c1
Sequence:CCGGCGGAGACTTCATTCTGGGTTACTCGAGTAACCCAGAATGAAGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172439.3-3250s21c1
Sequence:CCGGCAACTGTGACAATCAGCAAAGCTCGAGCTTTGCTGATTGTCACAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)