EMAIL THIS PAGE TO A FRIEND

INPP5K

inositol polyphosphate-5-phosphatase K

69 Gene Product Result for
Synonyms: PPS SKIP
Gene ID:
Human(51763) Summary: This gene encodes a protein with 5-phosphatase activity toward polyphosphate inositol. The protein localizes to the cytosol in regions lacking actin stress fibers. It is thought that this protein may negatively regulate the actin cytoskeleton. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
Mouse(19062) inositol polyphosphate 5-phosphatase K
Rat(287533) inositol polyphosphate-5-phosphatase K
Zebrafish(566188) inositol polyphosphate-5-phosphatase K
chicken(771549) inositol polyphosphate-5-phosphatase K
domestic cat(101085842) inositol polyphosphate-5-phosphatase K
cow(514123) inositol polyphosphate-5-phosphatase K
dog(480647) inositol polyphosphate-5-phosphatase K
domestic guinea pig(100718208) inositol polyphosphate-5-phosphatase K
naked mole-rat(101719531) inositol polyphosphate-5-phosphatase K
sheep(101115806) inositol polyphosphate-5-phosphatase K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016532 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068521 MISSION® esiRNA esiRNA human SKIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016532 Rosetta Predictions human pricing
NM_130766 Rosetta Predictions human pricing
NM_001013859 Rosetta Predictions rat pricing
NM_008916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200889 predicted 897
2 SASI_Hs01_00200890 predicted 473
3 SASI_Hs02_00349637 predicted 762
4 SASI_Hs01_00200891 predicted 906
5 SASI_Hs01_00200892 predicted 1376
6 SASI_Hs01_00200893 predicted 567
7 SASI_Hs01_00200894 predicted 1341
8 SASI_Hs01_00200895 predicted 1352
9 SASI_Hs01_00200896 predicted 767
10 SASI_Hs02_00349638 predicted 1183
11 SASI_Hs01_00200887 predicted 485
12 SASI_Hs01_00200888 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024172 predicted 1122
2 SASI_Hs01_00024173 predicted 697
3 SASI_Hs02_00362780 predicted 992
4 SASI_Hs01_00024174 predicted 1131
5 SASI_Hs01_00024175 predicted 1607
6 SASI_Hs01_00024176 predicted 794
7 SASI_Hs01_00024177 predicted 1572
8 SASI_Hs01_00024178 predicted 1580
9 SASI_Hs01_00024179 predicted 991
10 SASI_Hs02_00362781 predicted 1413
11 SASI_Hs01_00024170 predicted 717
12 SASI_Hs01_00024171 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085135 predicted 330
2 SASI_Rn01_00085136 predicted 503
3 SASI_Rn01_00085137 predicted 238
4 SASI_Rn01_00085138 predicted 748
5 SASI_Rn01_00085139 predicted 291
6 SASI_Rn01_00085140 predicted 851
7 SASI_Rn01_00085141 predicted 375
8 SASI_Rn01_00085142 predicted 990
9 SASI_Rn01_00085143 predicted 1212
10 SASI_Rn01_00085144 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069238 predicted 353
2 SASI_Mm01_00069239 predicted 258
3 SASI_Mm01_00069240 predicted 1290
4 SASI_Mm01_00069241 predicted 862
5 SASI_Mm01_00069242 predicted 1480
6 SASI_Mm01_00069243 predicted 1498
7 SASI_Mm01_00069245 predicted 720
8 SASI_Mm01_00069246 predicted 752
9 SASI_Mm01_00069247 predicted 1172
10 SASI_Mm02_00314949 predicted 769
11 SASI_Mm01_00069244 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016532
VALIDATED
INPP5K MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016532.3-699s21c1
Sequence:CCGGTATCAGCATTTGCCCTATATCCTCGAGGATATAGGGCAAATGCTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016532.2-282s1c2
Sequence:CCGGCGGAACCTCAATCTTGACATACTCGAGTATGTCAAGATTGAGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016532.3-1913s21c1
Sequence:CCGGTCTGGAATTAGCCGCTTAAATCTCGAGATTTAAGCGGCTAATTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016532.3-998s21c1
Sequence:CCGGCTTTGTTCGGGAATCCATTAACTCGAGTTAATGGATTCCCGAACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-1370s1c1
Sequence:CCGGCCCTACCACTGAAGATGAGTTCTCGAGAACTCATCTTCAGTGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-710s1c1
Sequence:CCGGCCACGACCTCATTATCTGGTTCTCGAGAACCAGATAATGAGGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-1205s1c1
Sequence:CCGGCTACTCTTCAACCTCGGACTTCTCGAGAAGTCCGAGGTTGAAGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-566s1c1
Sequence:CCGGCCTGAAGCTTTATGGCTACTACTCGAGTAGTAGCCATAAAGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-282s1c1
Sequence:CCGGCGGAACCTCAATCTTGACATACTCGAGTATGTCAAGATTGAGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016532.3-1995s21c1
Sequence:CCGGGGACAGTTCTGCGTCTCATTTCTCGAGAAATGAGACGCAGAACTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016532
VALIDATED
INPP5K MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016532.3-699s21c1
Sequence:CCGGTATCAGCATTTGCCCTATATCCTCGAGGATATAGGGCAAATGCTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016532.2-282s1c2
Sequence:CCGGCGGAACCTCAATCTTGACATACTCGAGTATGTCAAGATTGAGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016532.3-1913s21c1
Sequence:CCGGTCTGGAATTAGCCGCTTAAATCTCGAGATTTAAGCGGCTAATTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016532.3-998s21c1
Sequence:CCGGCTTTGTTCGGGAATCCATTAACTCGAGTTAATGGATTCCCGAACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-1370s1c1
Sequence:CCGGCCCTACCACTGAAGATGAGTTCTCGAGAACTCATCTTCAGTGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-710s1c1
Sequence:CCGGCCACGACCTCATTATCTGGTTCTCGAGAACCAGATAATGAGGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-1205s1c1
Sequence:CCGGCTACTCTTCAACCTCGGACTTCTCGAGAAGTCCGAGGTTGAAGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-566s1c1
Sequence:CCGGCCTGAAGCTTTATGGCTACTACTCGAGTAGTAGCCATAAAGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-282s1c1
Sequence:CCGGCGGAACCTCAATCTTGACATACTCGAGTATGTCAAGATTGAGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016532.3-1995s21c1
Sequence:CCGGGGACAGTTCTGCGTCTCATTTCTCGAGAAATGAGACGCAGAACTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016532
VALIDATED
INPP5K MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016532.3-699s21c1
Sequence:CCGGTATCAGCATTTGCCCTATATCCTCGAGGATATAGGGCAAATGCTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016532.2-282s1c2
Sequence:CCGGCGGAACCTCAATCTTGACATACTCGAGTATGTCAAGATTGAGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016532.3-1913s21c1
Sequence:CCGGTCTGGAATTAGCCGCTTAAATCTCGAGATTTAAGCGGCTAATTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016532.3-998s21c1
Sequence:CCGGCTTTGTTCGGGAATCCATTAACTCGAGTTAATGGATTCCCGAACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-1370s1c1
Sequence:CCGGCCCTACCACTGAAGATGAGTTCTCGAGAACTCATCTTCAGTGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-710s1c1
Sequence:CCGGCCACGACCTCATTATCTGGTTCTCGAGAACCAGATAATGAGGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-1205s1c1
Sequence:CCGGCTACTCTTCAACCTCGGACTTCTCGAGAAGTCCGAGGTTGAAGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-566s1c1
Sequence:CCGGCCTGAAGCTTTATGGCTACTACTCGAGTAGTAGCCATAAAGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016532.2-282s1c1
Sequence:CCGGCGGAACCTCAATCTTGACATACTCGAGTATGTCAAGATTGAGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016532.3-1995s21c1
Sequence:CCGGGGACAGTTCTGCGTCTCATTTCTCGAGAAATGAGACGCAGAACTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008916
VALIDATED
INPP5K MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase K
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-377s21c1
Sequence:CCGGCCCACTGAACTTTGTCAAGATCTCGAGATCTTGACAAAGTTCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008916.2-556s21c1
Sequence:CCGGACTACGTCAGCATCATCAATTCTCGAGAATTGATGATGCTGACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-1416s21c1
Sequence:CCGGCAACCCTTCAAGATCCCGATTCTCGAGAATCGGGATCTTGAAGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-1488s21c1
Sequence:CCGGGCCCAGATGGAAGTGAATGAACTCGAGTTCATTCACTTCCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-532s21c1
Sequence:CCGGACGTCTGCCTGAAGCTTTATGCTCGAGCATAAAGCTTCAGGCAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-377s1c1
Sequence:CCGGCCCACTGAACTTTGTCAAGATCTCGAGATCTTGACAAAGTTCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1489s1c1
Sequence:CCGGCCCAGATGGAAGTGAATGAATCTCGAGATTCATTCACTTCCATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1416s1c1
Sequence:CCGGCAACCCTTCAAGATCCCGATTCTCGAGAATCGGGATCTTGAAGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1488s1c1
Sequence:CCGGGCCCAGATGGAAGTGAATGAACTCGAGTTCATTCACTTCCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008916.2-584s1c1
Sequence:CCGGGCCTCCTCATATGTATAACAACTCGAGTTGTTATACATATGAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008916
VALIDATED
INPP5K MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase K
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-377s21c1
Sequence:CCGGCCCACTGAACTTTGTCAAGATCTCGAGATCTTGACAAAGTTCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008916.2-556s21c1
Sequence:CCGGACTACGTCAGCATCATCAATTCTCGAGAATTGATGATGCTGACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-1416s21c1
Sequence:CCGGCAACCCTTCAAGATCCCGATTCTCGAGAATCGGGATCTTGAAGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-1488s21c1
Sequence:CCGGGCCCAGATGGAAGTGAATGAACTCGAGTTCATTCACTTCCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-532s21c1
Sequence:CCGGACGTCTGCCTGAAGCTTTATGCTCGAGCATAAAGCTTCAGGCAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-377s1c1
Sequence:CCGGCCCACTGAACTTTGTCAAGATCTCGAGATCTTGACAAAGTTCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1489s1c1
Sequence:CCGGCCCAGATGGAAGTGAATGAATCTCGAGATTCATTCACTTCCATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1416s1c1
Sequence:CCGGCAACCCTTCAAGATCCCGATTCTCGAGAATCGGGATCTTGAAGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1488s1c1
Sequence:CCGGGCCCAGATGGAAGTGAATGAACTCGAGTTCATTCACTTCCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008916.2-584s1c1
Sequence:CCGGGCCTCCTCATATGTATAACAACTCGAGTTGTTATACATATGAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008916
VALIDATED
INPP5K MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase K
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-377s21c1
Sequence:CCGGCCCACTGAACTTTGTCAAGATCTCGAGATCTTGACAAAGTTCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008916.2-556s21c1
Sequence:CCGGACTACGTCAGCATCATCAATTCTCGAGAATTGATGATGCTGACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-1416s21c1
Sequence:CCGGCAACCCTTCAAGATCCCGATTCTCGAGAATCGGGATCTTGAAGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-1488s21c1
Sequence:CCGGGCCCAGATGGAAGTGAATGAACTCGAGTTCATTCACTTCCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008916.2-532s21c1
Sequence:CCGGACGTCTGCCTGAAGCTTTATGCTCGAGCATAAAGCTTCAGGCAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-377s1c1
Sequence:CCGGCCCACTGAACTTTGTCAAGATCTCGAGATCTTGACAAAGTTCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1489s1c1
Sequence:CCGGCCCAGATGGAAGTGAATGAATCTCGAGATTCATTCACTTCCATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1416s1c1
Sequence:CCGGCAACCCTTCAAGATCCCGATTCTCGAGAATCGGGATCTTGAAGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008916.2-1488s1c1
Sequence:CCGGGCCCAGATGGAAGTGAATGAACTCGAGTTCATTCACTTCCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008916.2-584s1c1
Sequence:CCGGGCCTCCTCATATGTATAACAACTCGAGTTGTTATACATATGAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)