EMAIL THIS PAGE TO A FRIEND

INPPL1

inositol polyphosphate phosphatase-like 1

72 Gene Product Result for
Synonyms: OPSMD SHIP2
UniProtKB ID: O15357, B2RTX5, Q13577, Q13578
Gene ID:
Human(3636) Summary: The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]
Mouse(16332) inositol polyphosphate phosphatase-like 1
Rat(65038) inositol polyphosphate phosphatase-like 1
sheep(101121707) inositol polyphosphate phosphatase-like 1
domestic guinea pig(100725170) inositol polyphosphate phosphatase-like 1
naked mole-rat(101698814) inositol polyphosphate phosphatase-like 1
chicken(428692) inositol polyphosphate phosphatase-like 1
domestic cat(101095611) inositol polyphosphate phosphatase-like 1
cow(783833) inositol polyphosphate phosphatase-like 1
dog(485209) inositol polyphosphate phosphatase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001567 siRNAs that have been validated in the lab human pricing
NM_022944 Rosetta Predictions rat pricing
NM_001122739 Rosetta Predictions mouse pricing
NM_010567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001567 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013991 validated 1128
2 SASI_Hs01_00013990 predicted 1776
3 SASI_Hs01_00013992 predicted 2402
4 SASI_Hs01_00013993 predicted 2368
5 SASI_Hs01_00013994 predicted 2268
6 SASI_Hs01_00013995 predicted 1764
7 SASI_Hs01_00013996 predicted 3128
8 SASI_Hs01_00013997 predicted 2618
9 SASI_Hs01_00013999 predicted 1963
10 SASI_Hs02_00332138 predicted 1105
11 SASI_Hs01_00013998 predicted 2219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052011 predicted 2396
2 SASI_Rn02_00263671 predicted 1613
3 SASI_Rn01_00052013 predicted 912
4 SASI_Rn01_00052014 predicted 2350
5 SASI_Rn01_00052015 predicted 2941
6 SASI_Rn01_00052016 predicted 2483
7 SASI_Rn01_00052017 predicted 2214
8 SASI_Rn02_00263672 predicted 2632
9 SASI_Rn01_00052019 predicted 2142
10 SASI_Rn02_00263673 predicted 1874
11 SASI_Rn01_00052012 predicted 1769
12 SASI_Rn01_00052018 predicted 3217
13 SASI_Rn01_00052020 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309331 predicted 2528
2 SASI_Mm02_00309332 predicted 2417
3 SASI_Mm02_00309333 predicted 1789
4 SASI_Mm02_00309334 predicted 2369
5 SASI_Mm02_00309335 predicted 1961
6 SASI_Mm02_00309336 predicted 2559
7 SASI_Mm02_00309337 predicted 2500
8 SASI_Mm02_00309338 predicted 1267
9 SASI_Mm02_00309339 predicted 2956
10 SASI_Mm02_00309340 predicted 2226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169137 predicted 2766
2 SASI_Mm01_00169138 predicted 2646
3 SASI_Mm01_00169146 predicted 2020
4 SASI_Mm01_00169139 predicted 2605
5 SASI_Mm01_00169140 predicted 2188
6 SASI_Mm01_00169141 predicted 2786
7 SASI_Mm01_00169142 predicted 2735
8 SASI_Mm01_00169143 predicted 1507
9 SASI_Mm01_00169144 predicted 3189
10 SASI_Mm01_00169145 predicted 2462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001567
VALIDATED
INPPL1 MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate phosphatase-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-3131s1c1
Sequence:CCGGCCACCCAAGAACAGCTTCAATCTCGAGATTGAAGCTGTTCTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-2062s1c1
Sequence:CCGGCCTGAACTACATCAGCAGGAACTCGAGTTCCTGCTGATGTAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-755s1c1
Sequence:CCGGGACTACCTGAAAGGCAGCTATCTCGAGATAGCTGCCTTTCAGGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-2275s1c1
Sequence:CCGGCCGGATTCTGTGGAAATCCTACTCGAGTAGGATTTCCACAGAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-697s21c1
Sequence:CCGGGACTACCTGAAAGGCAGCTATCTCGAGATAGCTGCCTTTCAGGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-2217s21c1
Sequence:CCGGCCGGATTCTGTGGAAATCCTACTCGAGTAGGATTTCCACAGAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-3073s21c1
Sequence:CCGGCCACCCAAGAACAGCTTCAATCTCGAGATTGAAGCTGTTCTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-2004s21c1
Sequence:CCGGCCTGAACTACATCAGCAGGAACTCGAGTTCCTGCTGATGTAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001567
VALIDATED
INPPL1 MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate phosphatase-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-3131s1c1
Sequence:CCGGCCACCCAAGAACAGCTTCAATCTCGAGATTGAAGCTGTTCTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-2062s1c1
Sequence:CCGGCCTGAACTACATCAGCAGGAACTCGAGTTCCTGCTGATGTAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-755s1c1
Sequence:CCGGGACTACCTGAAAGGCAGCTATCTCGAGATAGCTGCCTTTCAGGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-2275s1c1
Sequence:CCGGCCGGATTCTGTGGAAATCCTACTCGAGTAGGATTTCCACAGAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-697s21c1
Sequence:CCGGGACTACCTGAAAGGCAGCTATCTCGAGATAGCTGCCTTTCAGGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-2217s21c1
Sequence:CCGGCCGGATTCTGTGGAAATCCTACTCGAGTAGGATTTCCACAGAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-3073s21c1
Sequence:CCGGCCACCCAAGAACAGCTTCAATCTCGAGATTGAAGCTGTTCTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-2004s21c1
Sequence:CCGGCCTGAACTACATCAGCAGGAACTCGAGTTCCTGCTGATGTAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001567
VALIDATED
INPPL1 MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate phosphatase-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-3131s1c1
Sequence:CCGGCCACCCAAGAACAGCTTCAATCTCGAGATTGAAGCTGTTCTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-2062s1c1
Sequence:CCGGCCTGAACTACATCAGCAGGAACTCGAGTTCCTGCTGATGTAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-755s1c1
Sequence:CCGGGACTACCTGAAAGGCAGCTATCTCGAGATAGCTGCCTTTCAGGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001567.2-2275s1c1
Sequence:CCGGCCGGATTCTGTGGAAATCCTACTCGAGTAGGATTTCCACAGAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-697s21c1
Sequence:CCGGGACTACCTGAAAGGCAGCTATCTCGAGATAGCTGCCTTTCAGGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-2217s21c1
Sequence:CCGGCCGGATTCTGTGGAAATCCTACTCGAGTAGGATTTCCACAGAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-3073s21c1
Sequence:CCGGCCACCCAAGAACAGCTTCAATCTCGAGATTGAAGCTGTTCTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001567.3-2004s21c1
Sequence:CCGGCCTGAACTACATCAGCAGGAACTCGAGTTCCTGCTGATGTAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010567
VALIDATED
INPPL1 MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate phosphatase-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-4506s1c1
Sequence:CCGGCCACAGAGGAAGAGTTCCTTACTCGAGTAAGGAACTCTTCCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-1885s1c1
Sequence:CCGGCCGATTGCTATGCAGTCAATACTCGAGTATTGACTGCATAGCAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-3042s1c1
Sequence:CCGGGCTCTATGAATGGATTAGCATCTCGAGATGCTAATCCATTCATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010567.1-2461s1c1
Sequence:CCGGCGGATTCTATGGAAATCCTATCTCGAGATAGGATTTCCATAGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-1653s1c1
Sequence:CCGGCGACATGATCTCTGTCTTCATCTCGAGATGAAGACAGAGATCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-2471s21c1
Sequence:CCGGATAAGGTCTTCCTTCGATTTACTCGAGTAAATCGAAGGAAGACCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-823s21c1
Sequence:CCGGGGTGAGCTTATAGGCCTATATCTCGAGATATAGGCCTATAAGCTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-1803s21c1
Sequence:CCGGCGACATGATCTCTGTCTTCATCTCGAGATGAAGACAGAGATCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010567.2-3022s21c1
Sequence:CCGGATGGATGGCTACGAATCATATCTCGAGATATGATTCGTAGCCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-4774s21c1
Sequence:CCGGGAAGGGAGGGCACGTTAATTTCTCGAGAAATTAACGTGCCCTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010567
VALIDATED
INPPL1 MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate phosphatase-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-4506s1c1
Sequence:CCGGCCACAGAGGAAGAGTTCCTTACTCGAGTAAGGAACTCTTCCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-1885s1c1
Sequence:CCGGCCGATTGCTATGCAGTCAATACTCGAGTATTGACTGCATAGCAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-3042s1c1
Sequence:CCGGGCTCTATGAATGGATTAGCATCTCGAGATGCTAATCCATTCATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010567.1-2461s1c1
Sequence:CCGGCGGATTCTATGGAAATCCTATCTCGAGATAGGATTTCCATAGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-1653s1c1
Sequence:CCGGCGACATGATCTCTGTCTTCATCTCGAGATGAAGACAGAGATCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-2471s21c1
Sequence:CCGGATAAGGTCTTCCTTCGATTTACTCGAGTAAATCGAAGGAAGACCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-823s21c1
Sequence:CCGGGGTGAGCTTATAGGCCTATATCTCGAGATATAGGCCTATAAGCTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-1803s21c1
Sequence:CCGGCGACATGATCTCTGTCTTCATCTCGAGATGAAGACAGAGATCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010567.2-3022s21c1
Sequence:CCGGATGGATGGCTACGAATCATATCTCGAGATATGATTCGTAGCCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-4774s21c1
Sequence:CCGGGAAGGGAGGGCACGTTAATTTCTCGAGAAATTAACGTGCCCTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010567
VALIDATED
INPPL1 MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate phosphatase-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-4506s1c1
Sequence:CCGGCCACAGAGGAAGAGTTCCTTACTCGAGTAAGGAACTCTTCCTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-1885s1c1
Sequence:CCGGCCGATTGCTATGCAGTCAATACTCGAGTATTGACTGCATAGCAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-3042s1c1
Sequence:CCGGGCTCTATGAATGGATTAGCATCTCGAGATGCTAATCCATTCATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010567.1-2461s1c1
Sequence:CCGGCGGATTCTATGGAAATCCTATCTCGAGATAGGATTTCCATAGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010567.1-1653s1c1
Sequence:CCGGCGACATGATCTCTGTCTTCATCTCGAGATGAAGACAGAGATCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-2471s21c1
Sequence:CCGGATAAGGTCTTCCTTCGATTTACTCGAGTAAATCGAAGGAAGACCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-823s21c1
Sequence:CCGGGGTGAGCTTATAGGCCTATATCTCGAGATATAGGCCTATAAGCTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-1803s21c1
Sequence:CCGGCGACATGATCTCTGTCTTCATCTCGAGATGAAGACAGAGATCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010567.2-3022s21c1
Sequence:CCGGATGGATGGCTACGAATCATATCTCGAGATATGATTCGTAGCCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010567.2-4774s21c1
Sequence:CCGGGAAGGGAGGGCACGTTAATTTCTCGAGAAATTAACGTGCCCTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)