EMAIL THIS PAGE TO A FRIEND

INSIG1

insulin induced gene 1

181 Gene Product Result for
Synonyms: CL-6 CL6
UniProtKB ID: O15503, A4D2N1, A8K6L0, Q53XW8, Q9BUV5
Gene ID:
Human(3638) Summary: Oxysterols regulate cholesterol homeostasis through the liver X receptor (LXR)- and sterol regulatory element-binding protein (SREBP)-mediated signaling pathways. This gene is an insulin-induced gene. It encodes an endoplasmic reticulum (ER) membrane protein that plays a critical role in regulating cholesterol concentrations in cells. This protein binds to the sterol-sensing domains of SREBP cleavage-activating protein (SCAP) and HMG CoA reductase, and is essential for the sterol-mediated trafficking of the two proteins. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jun 2009]
Mouse(231070) insulin induced gene 1
Rat(64194) insulin induced gene 1
domestic guinea pig(100718114) insulin induced gene 1
naked mole-rat(101722021) insulin induced gene 1
sheep(101106422) insulin induced gene 1
Zebrafish(334189) insulin induced gene 1
cow(511899) insulin induced gene 1
dog(475554) insulin induced gene 1
domestic cat(101087651) insulin induced gene 1
chicken(420442) insulin induced gene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101165 Anti-INSIG1 (ab1) antibody produced in rabbit affinity isolated antibody, lyophilized powder human
western blot pricing
SAB2101166 Anti-INSIG1 (ab2) antibody produced in rabbit affinity isolated antibody bovine, rabbit, pig, sheep, human, horse, guinea pig, canine, mouse, rat, zebrafish, goat
western blot pricing
SAB2108161 Anti-INSIG1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2108317 Anti-INSIG1 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, mouse, pig, rat, human, canine, bovine
immunohistochemistry, western blot pricing
SAB2103102 Anti-INSIG1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2104446 Anti-INSIG1 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rabbit, human, pig, chicken, horse, rat, canine, bovine,
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005542 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005542 Rosetta Predictions human pricing
NM_198336 Rosetta Predictions human pricing
NM_198337 Rosetta Predictions human pricing
NM_022392 Rosetta Predictions rat pricing
NM_153526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184086 predicted 1202
2 SASI_Hs01_00184087 predicted 1365
3 SASI_Hs01_00184088 predicted 827
4 SASI_Hs01_00184089 predicted 1386
5 SASI_Hs01_00184090 predicted 1391
6 SASI_Hs02_00339782 predicted 1261
7 SASI_Hs01_00184092 predicted 832
8 SASI_Hs01_00184093 predicted 750
9 SASI_Hs01_00184094 predicted 972
10 SASI_Hs01_00184095 predicted 931
11 SASI_Hs01_00184091 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049369 predicted 1267
2 SASI_Hs01_00049370 predicted 1434
3 SASI_Hs01_00049371 predicted 822
4 SASI_Hs02_00371886 predicted 1332
5 SASI_Hs01_00049373 predicted 836
6 SASI_Hs01_00049374 predicted 940
7 SASI_Hs01_00049375 predicted 1017
8 SASI_Hs01_00049376 predicted 756
9 SASI_Hs01_00049377 predicted 966
10 SASI_Hs01_00049378 predicted 1045
11 SASI_Hs01_00049372 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018534 predicted 909
2 SASI_Hs01_00018535 predicted 1093
3 SASI_Hs01_00018536 predicted 1117
4 SASI_Hs01_00018537 predicted 1101
5 SASI_Hs01_00018538 predicted 460
6 SASI_Hs01_00018539 predicted 1000
7 SASI_Hs01_00018540 predicted 549
8 SASI_Hs02_00371887 predicted 1081
9 SASI_Hs01_00018541 predicted 389
10 SASI_Hs01_00018542 predicted 959
11 SASI_Hs01_00018543 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059256 predicted 1038
2 SASI_Rn01_00059257 predicted 941
3 SASI_Rn01_00059258 predicted 992
4 SASI_Rn01_00059260 predicted 979
5 SASI_Rn01_00059262 predicted 1053
6 SASI_Rn02_00263159 predicted 414
7 SASI_Rn02_00263160 predicted 521
8 SASI_Rn01_00059264 predicted 991
9 SASI_Rn02_00263161 predicted 1085
10 SASI_Rn02_00263162 predicted 506
11 SASI_Rn01_00059259 predicted 401
12 SASI_Rn01_00059261 predicted 418
13 SASI_Rn01_00059263 predicted 533
14 SASI_Rn01_00059265 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056250 predicted 919
2 SASI_Mm01_00056251 predicted 389
3 SASI_Mm01_00056252 predicted 1073
4 SASI_Mm01_00056253 predicted 849
5 SASI_Mm01_00056254 predicted 914
6 SASI_Mm01_00056255 predicted 443
7 SASI_Mm01_00056256 predicted 398
8 SASI_Mm01_00056257 predicted 930
9 SASI_Mm02_00343291 predicted 1017
10 SASI_Mm01_00056258 predicted 905
11 SASI_Mm01_00056259 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005542
VALIDATED
INSIG1 MISSION shRNA Bacterial Glycerol Stock
insulin induced gene 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005542.4-1034s21c1
Sequence:CCGGCATAGTGATTGAGTCTTCAAACTCGAGTTTGAAGACTCAATCACTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005542.4-990s21c1
Sequence:CCGGGGAACATAGGACGACAGTTAGCTCGAGCTAACTGTCGTCCTATGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-1373s21c1
Sequence:CCGGCTTGAACTAAGACTCAATTACCTCGAGGTAATTGAGTCTTAGTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-733s21c1
Sequence:CCGGTAACCACGCCAGTGCTAAATTCTCGAGAATTTAGCACTGGCGTGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-901s21c1
Sequence:CCGGTAATGGTGTCTATCAGTATACCTCGAGGTATACTGATAGACACCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005542.3-2379s1c1
Sequence:CCGGCGCTGGTCTTTGTGTTTGGTTCTCGAGAACCAAACACAAAGACCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005542.3-826s1c1
Sequence:CCGGCACGCAGTTTCTCGTGTATAACTCGAGTTATACACGAGAAACTGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005542.3-2133s1c1
Sequence:CCGGCGGCAATGATTTCTTTCAGTTCTCGAGAACTGAAAGAAATCATTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005542.3-2592s1c1
Sequence:CCGGCCAATGAAGATGTCAGCATTTCTCGAGAAATGCTGACATCTTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005542.3-682s1c1
Sequence:CCGGCGCCAGTGCTAAATTGGATTTCTCGAGAAATCCAATTTAGCACTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005542
VALIDATED
INSIG1 MISSION shRNA shRNA Plasmid DNA
insulin induced gene 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005542.4-1034s21c1
Sequence:CCGGCATAGTGATTGAGTCTTCAAACTCGAGTTTGAAGACTCAATCACTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005542.4-990s21c1
Sequence:CCGGGGAACATAGGACGACAGTTAGCTCGAGCTAACTGTCGTCCTATGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-1373s21c1
Sequence:CCGGCTTGAACTAAGACTCAATTACCTCGAGGTAATTGAGTCTTAGTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-733s21c1
Sequence:CCGGTAACCACGCCAGTGCTAAATTCTCGAGAATTTAGCACTGGCGTGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-901s21c1
Sequence:CCGGTAATGGTGTCTATCAGTATACCTCGAGGTATACTGATAGACACCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005542.3-2379s1c1
Sequence:CCGGCGCTGGTCTTTGTGTTTGGTTCTCGAGAACCAAACACAAAGACCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005542.3-826s1c1
Sequence:CCGGCACGCAGTTTCTCGTGTATAACTCGAGTTATACACGAGAAACTGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005542.3-2133s1c1
Sequence:CCGGCGGCAATGATTTCTTTCAGTTCTCGAGAACTGAAAGAAATCATTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005542.3-2592s1c1
Sequence:CCGGCCAATGAAGATGTCAGCATTTCTCGAGAAATGCTGACATCTTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005542.3-682s1c1
Sequence:CCGGCGCCAGTGCTAAATTGGATTTCTCGAGAAATCCAATTTAGCACTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005542
VALIDATED
INSIG1 MISSION shRNA Lentiviral Transduction Particles
insulin induced gene 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005542.4-1034s21c1
Sequence:CCGGCATAGTGATTGAGTCTTCAAACTCGAGTTTGAAGACTCAATCACTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005542.4-990s21c1
Sequence:CCGGGGAACATAGGACGACAGTTAGCTCGAGCTAACTGTCGTCCTATGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-1373s21c1
Sequence:CCGGCTTGAACTAAGACTCAATTACCTCGAGGTAATTGAGTCTTAGTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-733s21c1
Sequence:CCGGTAACCACGCCAGTGCTAAATTCTCGAGAATTTAGCACTGGCGTGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005542.4-901s21c1
Sequence:CCGGTAATGGTGTCTATCAGTATACCTCGAGGTATACTGATAGACACCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005542.3-2379s1c1
Sequence:CCGGCGCTGGTCTTTGTGTTTGGTTCTCGAGAACCAAACACAAAGACCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005542.3-826s1c1
Sequence:CCGGCACGCAGTTTCTCGTGTATAACTCGAGTTATACACGAGAAACTGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005542.3-2133s1c1
Sequence:CCGGCGGCAATGATTTCTTTCAGTTCTCGAGAACTGAAAGAAATCATTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005542.3-2592s1c1
Sequence:CCGGCCAATGAAGATGTCAGCATTTCTCGAGAAATGCTGACATCTTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005542.3-682s1c1
Sequence:CCGGCGCCAGTGCTAAATTGGATTTCTCGAGAAATCCAATTTAGCACTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153526
INSIG1 MISSION shRNA Bacterial Glycerol Stock
insulin induced gene 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-439s1c1
Sequence:CCGGCGGTTTACTGTATCCCTGTATCTCGAGATACAGGGATACAGTAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-809s1c1
Sequence:CCGGCGACAGTTAGCTATGGGTGTTCTCGAGAACACCCATAGCTAACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-503s1c1
Sequence:CCGGGCCAGCGTTATGCGCTGTATTCTCGAGAATACAGCGCATAACGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-680s1c1
Sequence:CCGGGCTACGCTGATCACTCAGTTTCTCGAGAAACTGAGTGATCAGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153526.2-1983s1c1
Sequence:CCGGCCTCTGACATACTCCAGCTTTCTCGAGAAAGCTGGAGTATGTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153526
INSIG1 MISSION shRNA shRNA Plasmid DNA
insulin induced gene 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-439s1c1
Sequence:CCGGCGGTTTACTGTATCCCTGTATCTCGAGATACAGGGATACAGTAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-809s1c1
Sequence:CCGGCGACAGTTAGCTATGGGTGTTCTCGAGAACACCCATAGCTAACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-503s1c1
Sequence:CCGGGCCAGCGTTATGCGCTGTATTCTCGAGAATACAGCGCATAACGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-680s1c1
Sequence:CCGGGCTACGCTGATCACTCAGTTTCTCGAGAAACTGAGTGATCAGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153526.2-1983s1c1
Sequence:CCGGCCTCTGACATACTCCAGCTTTCTCGAGAAAGCTGGAGTATGTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153526
INSIG1 MISSION shRNA Lentiviral Transduction Particles
insulin induced gene 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-439s1c1
Sequence:CCGGCGGTTTACTGTATCCCTGTATCTCGAGATACAGGGATACAGTAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-809s1c1
Sequence:CCGGCGACAGTTAGCTATGGGTGTTCTCGAGAACACCCATAGCTAACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-503s1c1
Sequence:CCGGGCCAGCGTTATGCGCTGTATTCTCGAGAATACAGCGCATAACGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153526.2-680s1c1
Sequence:CCGGGCTACGCTGATCACTCAGTTTCTCGAGAAACTGAGTGATCAGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153526.2-1983s1c1
Sequence:CCGGCCTCTGACATACTCCAGCTTTCTCGAGAAAGCTGGAGTATGTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)