EMAIL THIS PAGE TO A FRIEND

INSIG2

insulin induced gene 2

133 Gene Product Result for
UniProtKB ID: Q9Y5U4, A8K5W8, Q8TBI8
Gene ID:
Human(51141) Summary: The protein encoded by this gene is highly similar to the protein product encoded by gene INSIG1. Both INSIG1 protein and this protein are endoplasmic reticulum proteins that block the processing of sterol regulatory element binding proteins (SREBPs) by binding to SREBP cleavage-activating protein (SCAP), and thus prevent SCAP from escorting SREBPs to the Golgi. [provided by RefSeq, Jul 2008]
Mouse(72999) insulin induced gene 2
Rat(288985) insulin induced gene 2
Zebrafish(399645) insulin induced gene 2
cow(534440) insulin induced gene 2
domestic cat(101083870) insulin induced gene 2
dog(610496) insulin induced gene 2
chicken(424276) insulin induced gene 2
Goat(100861144) insulin induced gene 2
sheep(101110569) insulin induced gene 2
domestic guinea pig(100735788) insulin induced gene 2
naked mole-rat(101709894) insulin induced gene 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300996 Anti-INSIG2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2103103 Anti-INSIG2, (N-terminal) antibody produced in rabbit affinity isolated antibody sheep, goat, human, horse, bovine, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016133 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016133 Rosetta Predictions human pricing
NM_178091 Rosetta Predictions rat pricing
NM_133748 Rosetta Predictions mouse pricing
NM_178082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069372 predicted 761
2 SASI_Hs01_00069373 predicted 604
3 SASI_Hs01_00069374 predicted 705
4 SASI_Hs01_00069375 predicted 563
5 SASI_Hs01_00069376 predicted 710
6 SASI_Hs01_00069377 predicted 539
7 SASI_Hs01_00069378 predicted 477
8 SASI_Hs01_00069381 predicted 677
9 SASI_Hs02_00348927 predicted 486
10 SASI_Hs02_00348928 predicted 534
11 SASI_Hs01_00069379 predicted 382
12 SASI_Hs01_00069380 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109490 predicted 299
2 SASI_Rn02_00269608 predicted 236
3 SASI_Rn02_00269609 predicted 356
4 SASI_Rn02_00269610 predicted 263
5 SASI_Rn01_00109493 predicted 384
6 SASI_Rn01_00109494 predicted 296
7 SASI_Rn02_00269611 predicted 356
8 SASI_Rn02_00269612 predicted 197
9 SASI_Rn02_00269613 predicted 322
10 SASI_Rn02_00269614 predicted 268
11 SASI_Rn01_00109491 predicted 661
12 SASI_Rn01_00109492 predicted 589
13 SASI_Rn01_00109495 predicted 678
14 SASI_Rn01_00109496 predicted 331
15 SASI_Rn01_00109497 predicted 675
16 SASI_Rn01_00109498 predicted 693
17 SASI_Rn01_00109499 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106102 predicted 376
2 SASI_Mm01_00106103 predicted 700
3 SASI_Mm01_00106104 predicted 541
4 SASI_Mm01_00106105 predicted 314
5 SASI_Mm01_00106106 predicted 719
6 SASI_Mm02_00338735 predicted 343
7 SASI_Mm01_00106107 predicted 707
8 SASI_Mm01_00106108 predicted 418
9 SASI_Mm01_00106109 predicted 565
10 SASI_Mm01_00106110 predicted 676
11 SASI_Mm01_00106111 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024602 predicted 390
2 SASI_Mm01_00024603 predicted 712
3 SASI_Mm01_00024604 predicted 552
4 SASI_Mm01_00024605 predicted 329
5 SASI_Mm01_00024606 predicted 734
6 SASI_Mm02_00348556 predicted 360
7 SASI_Mm01_00024607 predicted 728
8 SASI_Mm01_00024608 predicted 428
9 SASI_Mm01_00024609 predicted 579
10 SASI_Mm01_00024610 predicted 697
11 SASI_Mm01_00024611 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133748
VALIDATED
INSIG2 MISSION shRNA Bacterial Glycerol Stock
insulin induced gene 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-717s21c1
Sequence:CCGGGTTAGTCTACAATGGTGTTTACTCGAGTAAACACCATTGTAGACTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-572s1c1
Sequence:CCGGCTAAAGTAGACTTCGACAACACTCGAGTGTTGTCGAAGTCTACTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133748.1-880s21c1
Sequence:CCGGTGAAGAGGGCAGACGTCTTATCTCGAGATAAGACGTCTGCCCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-484s21c1
Sequence:CCGGCATCTAGGAGAACCTCATAAACTCGAGTTTATGAGGTTCTCCTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-484s1c1
Sequence:CCGGCATCTAGGAGAACCTCATAAACTCGAGTTTATGAGGTTCTCCTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133748.1-1440s1c1
Sequence:CCGGGCATTGTTGTAGGGACCCAAACTCGAGTTTGGGTCCCTACAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-717s1c1
Sequence:CCGGGTTAGTCTACAATGGTGTTTACTCGAGTAAACACCATTGTAGACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-2089s21c1
Sequence:CCGGTATAGTGTCAGGTAGACATTTCTCGAGAAATGTCTACCTGACACTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133748
VALIDATED
INSIG2 MISSION shRNA shRNA Plasmid DNA
insulin induced gene 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-717s21c1
Sequence:CCGGGTTAGTCTACAATGGTGTTTACTCGAGTAAACACCATTGTAGACTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-572s1c1
Sequence:CCGGCTAAAGTAGACTTCGACAACACTCGAGTGTTGTCGAAGTCTACTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133748.1-880s21c1
Sequence:CCGGTGAAGAGGGCAGACGTCTTATCTCGAGATAAGACGTCTGCCCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-484s21c1
Sequence:CCGGCATCTAGGAGAACCTCATAAACTCGAGTTTATGAGGTTCTCCTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-484s1c1
Sequence:CCGGCATCTAGGAGAACCTCATAAACTCGAGTTTATGAGGTTCTCCTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133748.1-1440s1c1
Sequence:CCGGGCATTGTTGTAGGGACCCAAACTCGAGTTTGGGTCCCTACAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-717s1c1
Sequence:CCGGGTTAGTCTACAATGGTGTTTACTCGAGTAAACACCATTGTAGACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-2089s21c1
Sequence:CCGGTATAGTGTCAGGTAGACATTTCTCGAGAAATGTCTACCTGACACTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133748
VALIDATED
INSIG2 MISSION shRNA Lentiviral Transduction Particles
insulin induced gene 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-717s21c1
Sequence:CCGGGTTAGTCTACAATGGTGTTTACTCGAGTAAACACCATTGTAGACTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-572s1c1
Sequence:CCGGCTAAAGTAGACTTCGACAACACTCGAGTGTTGTCGAAGTCTACTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133748.1-880s21c1
Sequence:CCGGTGAAGAGGGCAGACGTCTTATCTCGAGATAAGACGTCTGCCCTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-484s21c1
Sequence:CCGGCATCTAGGAGAACCTCATAAACTCGAGTTTATGAGGTTCTCCTAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-484s1c1
Sequence:CCGGCATCTAGGAGAACCTCATAAACTCGAGTTTATGAGGTTCTCCTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133748.1-1440s1c1
Sequence:CCGGGCATTGTTGTAGGGACCCAAACTCGAGTTTGGGTCCCTACAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133748.1-717s1c1
Sequence:CCGGGTTAGTCTACAATGGTGTTTACTCGAGTAAACACCATTGTAGACTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133748.1-2089s21c1
Sequence:CCGGTATAGTGTCAGGTAGACATTTCTCGAGAAATGTCTACCTGACACTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016133
VALIDATED
INSIG2 MISSION shRNA Bacterial Glycerol Stock
insulin induced gene 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-448s21c1
Sequence:CCGGCAGCTGTGATTGGGTTATTATCTCGAGATAATAACCCAATCACAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-1391s21c1
Sequence:CCGGGAGTTATGAGTGCCCTAATTTCTCGAGAAATTAGGGCACTCATAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-543s21c1
Sequence:CCGGGCAGTCTTTGTTGGTATAAATCTCGAGATTTATACCAACAAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016133.2-846s1c1
Sequence:CCGGGAATGTAAAGTTATCGCAGAACTCGAGTTCTGCGATAACTTTACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-728s21c1
Sequence:CCGGTAATGGTGTTTACCAATATACCTCGAGGTATATTGGTAAACACCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-294s21c1
Sequence:CCGGATTCGAGGAGTAGTGCTATTTCTCGAGAAATAGCACTACTCCTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016133
VALIDATED
INSIG2 MISSION shRNA shRNA Plasmid DNA
insulin induced gene 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-448s21c1
Sequence:CCGGCAGCTGTGATTGGGTTATTATCTCGAGATAATAACCCAATCACAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-1391s21c1
Sequence:CCGGGAGTTATGAGTGCCCTAATTTCTCGAGAAATTAGGGCACTCATAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-543s21c1
Sequence:CCGGGCAGTCTTTGTTGGTATAAATCTCGAGATTTATACCAACAAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016133.2-846s1c1
Sequence:CCGGGAATGTAAAGTTATCGCAGAACTCGAGTTCTGCGATAACTTTACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-728s21c1
Sequence:CCGGTAATGGTGTTTACCAATATACCTCGAGGTATATTGGTAAACACCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-294s21c1
Sequence:CCGGATTCGAGGAGTAGTGCTATTTCTCGAGAAATAGCACTACTCCTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016133
VALIDATED
INSIG2 MISSION shRNA Lentiviral Transduction Particles
insulin induced gene 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-448s21c1
Sequence:CCGGCAGCTGTGATTGGGTTATTATCTCGAGATAATAACCCAATCACAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-1391s21c1
Sequence:CCGGGAGTTATGAGTGCCCTAATTTCTCGAGAAATTAGGGCACTCATAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-543s21c1
Sequence:CCGGGCAGTCTTTGTTGGTATAAATCTCGAGATTTATACCAACAAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016133.2-846s1c1
Sequence:CCGGGAATGTAAAGTTATCGCAGAACTCGAGTTCTGCGATAACTTTACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-728s21c1
Sequence:CCGGTAATGGTGTTTACCAATATACCTCGAGGTATATTGGTAAACACCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016133.2-294s21c1
Sequence:CCGGATTCGAGGAGTAGTGCTATTTCTCGAGAAATAGCACTACTCCTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)