EMAIL THIS PAGE TO A FRIEND

INSL3

insulin-like 3 (Leydig cell)

43 Gene Product Result for
Synonyms: RLF RLNL ley-I-L
Gene ID:
Human(3640) Summary: This gene encodes a member of the insulin-like hormone superfamily. The encoded protein is mainly produced in gonadal tissues. Studies of the mouse counterpart suggest that this gene may be involved in the development of urogenital tract and female fertility. This protein may also act as a hormone to regulate growth and differentiation of gubernaculum, and thus mediating intra-abdominal testicular descent. Mutations in this gene may lead to cryptorchidism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Mouse(16336) insulin-like 3
Rat(114215) insulin-like 3
Zebrafish(563417) insulin-like 3 (Leydig cell)
cow(281870) insulin-like 3 (Leydig cell)
domestic cat(101084860) insulin-like 3 (Leydig cell)
Horse(100146149) insulin-like 3 (Leydig cell)
dog(403436) insulin-like 3 (Leydig cell)
domestic guinea pig(100713622) insulin-like 3 (Leydig cell)
naked mole-rat(101715115) insulin-like 3 (Leydig cell)
Goat(100861214) insulin-like 3 (Leydig cell)
sheep(554252) insulin-like 3 (Leydig cell)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005543 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005543 Rosetta Predictions human pricing
NM_053680 Rosetta Predictions rat pricing
NM_013564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160093 predicted 348
2 SASI_Hs01_00160094 predicted 473
3 SASI_Hs01_00160095 predicted 322
4 SASI_Hs01_00160096 predicted 469
5 SASI_Hs01_00160097 predicted 377
6 SASI_Hs01_00160098 predicted 483
7 SASI_Hs01_00160099 predicted 463
8 SASI_Hs01_00160100 predicted 350
9 SASI_Hs01_00160092 predicted 399
10 SASI_Hs02_00339783 predicted 368
11 SASI_Hs01_00160101 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043461 predicted 208
2 SASI_Rn01_00043462 predicted 195
3 SASI_Rn01_00043463 predicted 557
4 SASI_Rn01_00043464 predicted 550
5 SASI_Rn01_00043465 predicted 296
6 SASI_Rn01_00043466 predicted 449
7 SASI_Rn01_00043467 predicted 559
8 SASI_Rn01_00043468 predicted 397
9 SASI_Rn01_00043469 predicted 65
10 SASI_Rn01_00043470 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170954 predicted 311
2 SASI_Mm01_00170955 predicted 243
3 SASI_Mm01_00170956 predicted 227
4 SASI_Mm02_00322304 predicted 282
5 SASI_Mm01_00170957 predicted 303
6 SASI_Mm01_00170958 predicted 246
7 SASI_Mm01_00170959 predicted 199
8 SASI_Mm01_00170960 predicted 308
9 SASI_Mm01_00170961 predicted 246
10 SASI_Mm01_00170962 predicted 313
11 SASI_Mm01_00170963 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005543
INSL3 MISSION shRNA Bacterial Glycerol Stock
insulin-like 3 (Leydig cell)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005543.2-633s21c1
Sequence:CCGGGGACACTGACAGCCAAATGTCCTCGAGGACATTTGGCTGTCAGTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005543.2-217s21c1
Sequence:CCGGAGAGACGACATCTGCTCCATGCTCGAGCATGGAGCAGATGTCGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005543.2-466s21c1
Sequence:CCGGAGGCCACACAGCACCATAAAGCTCGAGCTTTATGGTGCTGTGTGGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005543.2-502s1c1
Sequence:CCGGCCTTTGATTACCTCCTGGGATCTCGAGATCCCAGGAGGTAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-83s1c1
Sequence:CCGGCCCAGAGATGCGTGAGAAGTTCTCGAGAACTTCTCACGCATCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-190s1c1
Sequence:CCGGGCGACCGTGAGTTGCTACAGTCTCGAGACTGTAGCAACTCACGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-249s1c1
Sequence:CCGGGACAGTAATCTCACGCTGGGACTCGAGTCCCAGCGTGAGATTACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-356s1c1
Sequence:CCGGCAGTGGCTGTACCCAACAAGACTCGAGTCTTGTTGGGTACAGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005543
INSL3 MISSION shRNA shRNA Plasmid DNA
insulin-like 3 (Leydig cell)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005543.2-633s21c1
Sequence:CCGGGGACACTGACAGCCAAATGTCCTCGAGGACATTTGGCTGTCAGTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005543.2-217s21c1
Sequence:CCGGAGAGACGACATCTGCTCCATGCTCGAGCATGGAGCAGATGTCGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005543.2-466s21c1
Sequence:CCGGAGGCCACACAGCACCATAAAGCTCGAGCTTTATGGTGCTGTGTGGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005543.2-502s1c1
Sequence:CCGGCCTTTGATTACCTCCTGGGATCTCGAGATCCCAGGAGGTAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-83s1c1
Sequence:CCGGCCCAGAGATGCGTGAGAAGTTCTCGAGAACTTCTCACGCATCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-190s1c1
Sequence:CCGGGCGACCGTGAGTTGCTACAGTCTCGAGACTGTAGCAACTCACGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-249s1c1
Sequence:CCGGGACAGTAATCTCACGCTGGGACTCGAGTCCCAGCGTGAGATTACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-356s1c1
Sequence:CCGGCAGTGGCTGTACCCAACAAGACTCGAGTCTTGTTGGGTACAGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005543
INSL3 MISSION shRNA Lentiviral Transduction Particles
insulin-like 3 (Leydig cell)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005543.2-633s21c1
Sequence:CCGGGGACACTGACAGCCAAATGTCCTCGAGGACATTTGGCTGTCAGTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005543.2-217s21c1
Sequence:CCGGAGAGACGACATCTGCTCCATGCTCGAGCATGGAGCAGATGTCGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005543.2-466s21c1
Sequence:CCGGAGGCCACACAGCACCATAAAGCTCGAGCTTTATGGTGCTGTGTGGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005543.2-502s1c1
Sequence:CCGGCCTTTGATTACCTCCTGGGATCTCGAGATCCCAGGAGGTAATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-83s1c1
Sequence:CCGGCCCAGAGATGCGTGAGAAGTTCTCGAGAACTTCTCACGCATCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-190s1c1
Sequence:CCGGGCGACCGTGAGTTGCTACAGTCTCGAGACTGTAGCAACTCACGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-249s1c1
Sequence:CCGGGACAGTAATCTCACGCTGGGACTCGAGTCCCAGCGTGAGATTACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005543.2-356s1c1
Sequence:CCGGCAGTGGCTGTACCCAACAAGACTCGAGTCTTGTTGGGTACAGCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013564
INSL3 MISSION shRNA Bacterial Glycerol Stock
insulin-like 3 (Leydig cell)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-244s1c1
Sequence:CCGGCCAGCGCTAGACCCGCAGCTTCTCGAGAAGCTGCGGGTCTAGCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-320s1c1
Sequence:CCGGGCTGCTGTCTTACTGGCTGCACTCGAGTGCAGCCAGTAAGACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013564.4-468s1c1
Sequence:CCGGGTTTATTCATAGATCGCAGTACTCGAGTACTGCGATCTATGAATAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-257s1c1
Sequence:CCGGCGCAGCTTCCTCTCCAGGCTTCTCGAGAAGCCTGGAGAGGAAGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-193s1c1
Sequence:CCGGCAGTGGCTAGAGCAGAGACATCTCGAGATGTCTCTGCTCTAGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013564
INSL3 MISSION shRNA shRNA Plasmid DNA
insulin-like 3 (Leydig cell)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-244s1c1
Sequence:CCGGCCAGCGCTAGACCCGCAGCTTCTCGAGAAGCTGCGGGTCTAGCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-320s1c1
Sequence:CCGGGCTGCTGTCTTACTGGCTGCACTCGAGTGCAGCCAGTAAGACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013564.4-468s1c1
Sequence:CCGGGTTTATTCATAGATCGCAGTACTCGAGTACTGCGATCTATGAATAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-257s1c1
Sequence:CCGGCGCAGCTTCCTCTCCAGGCTTCTCGAGAAGCCTGGAGAGGAAGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-193s1c1
Sequence:CCGGCAGTGGCTAGAGCAGAGACATCTCGAGATGTCTCTGCTCTAGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013564
INSL3 MISSION shRNA Lentiviral Transduction Particles
insulin-like 3 (Leydig cell)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-244s1c1
Sequence:CCGGCCAGCGCTAGACCCGCAGCTTCTCGAGAAGCTGCGGGTCTAGCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-320s1c1
Sequence:CCGGGCTGCTGTCTTACTGGCTGCACTCGAGTGCAGCCAGTAAGACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013564.4-468s1c1
Sequence:CCGGGTTTATTCATAGATCGCAGTACTCGAGTACTGCGATCTATGAATAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-257s1c1
Sequence:CCGGCGCAGCTTCCTCTCCAGGCTTCTCGAGAAGCCTGGAGAGGAAGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013564.4-193s1c1
Sequence:CCGGCAGTGGCTAGAGCAGAGACATCTCGAGATGTCTCTGCTCTAGCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)