EMAIL THIS PAGE TO A FRIEND

INSL4

insulin-like 4 (placenta)

27 Gene Product Result for
Synonyms: EPIL PLACENTIN
Species: Human INSL4(3641)
UniProtKB ID: Q14641, A8K678, Q5W127
Gene ID:
Human(3641) Summary: INSL4 encodes the insulin-like 4 protein, a member of the insulin superfamily. INSL4 encodes a precursor that undergoes post-translational cleavage to produce 3 polypeptide chains, A-C, that form tertiary structures composed of either all three chains, or just the A and B chains. Expression of INSL4 products occurs within the early placental cytotrophoblast and syncytiotrophoblast. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501554 Anti-INSL4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002195 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027611 MISSION® esiRNA esiRNA human INSL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002195 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045838 predicted 326
2 SASI_Hs01_00045839 predicted 394
3 SASI_Hs01_00045840 predicted 346
4 SASI_Hs01_00045841 predicted 335
5 SASI_Hs02_00333415 predicted 334
6 SASI_Hs01_00045843 predicted 299
7 SASI_Hs02_00333416 predicted 302
8 SASI_Hs01_00045844 predicted 329
9 SASI_Hs02_00333417 predicted 261
10 SASI_Hs01_00045845 predicted 324
11 SASI_Hs01_00045842 predicted 392
12 SASI_Hs01_00045846 predicted 349
13 SASI_Hs01_00045847 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002195
VALIDATED
INSL4 MISSION shRNA Bacterial Glycerol Stock
insulin-like 4 (placenta)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-337s1c1
Sequence:CCGGGCCTTAGGTACGACATCAGAACTCGAGTTCTGATGTCGTACCTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-151s1c1
Sequence:CCGGCTGAGCCAACTCCTTAGAGAACTCGAGTTCTCTAAGGAGTTGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-292s1c1
Sequence:CCGGCGTCCCAAAGAAATGGTGTCACTCGAGTGACACCATTTCTTTGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-339s1c1
Sequence:CCGGCTTAGGTACGACATCAGAATTCTCGAGAATTCTGATGTCGTACCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-453s1c1
Sequence:CCGGACGTCACAGATTTGATCCATTCTCGAGAATGGATCAAATCTGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-314s21c1
Sequence:CCGGCCTCCAACAACAAAGATGGACCTCGAGGTCCATCTTTGTTGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-361s21c1
Sequence:CCGGATTCCTAATTTGTCACCAGAGCTCGAGCTCTGGTGACAAATTAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-151s21c1
Sequence:CCGGCTGAGCCAACTCCTTAGAGAACTCGAGTTCTCTAAGGAGTTGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-237s21c1
Sequence:CCGGCATGCCTGAGAAGACATTCACCTCGAGGTGAATGTCTTCTCAGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-292s21c1
Sequence:CCGGCGTCCCAAAGAAATGGTGTCACTCGAGTGACACCATTTCTTTGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-337s21c1
Sequence:CCGGGCCTTAGGTACGACATCAGAACTCGAGTTCTGATGTCGTACCTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-397s21c1
Sequence:CCGGTCTGAAGGGCAGCCATCATTGCTCGAGCAATGATGGCTGCCCTTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002195
VALIDATED
INSL4 MISSION shRNA shRNA Plasmid DNA
insulin-like 4 (placenta)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-337s1c1
Sequence:CCGGGCCTTAGGTACGACATCAGAACTCGAGTTCTGATGTCGTACCTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-151s1c1
Sequence:CCGGCTGAGCCAACTCCTTAGAGAACTCGAGTTCTCTAAGGAGTTGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-292s1c1
Sequence:CCGGCGTCCCAAAGAAATGGTGTCACTCGAGTGACACCATTTCTTTGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-339s1c1
Sequence:CCGGCTTAGGTACGACATCAGAATTCTCGAGAATTCTGATGTCGTACCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-453s1c1
Sequence:CCGGACGTCACAGATTTGATCCATTCTCGAGAATGGATCAAATCTGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-314s21c1
Sequence:CCGGCCTCCAACAACAAAGATGGACCTCGAGGTCCATCTTTGTTGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-361s21c1
Sequence:CCGGATTCCTAATTTGTCACCAGAGCTCGAGCTCTGGTGACAAATTAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-151s21c1
Sequence:CCGGCTGAGCCAACTCCTTAGAGAACTCGAGTTCTCTAAGGAGTTGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-237s21c1
Sequence:CCGGCATGCCTGAGAAGACATTCACCTCGAGGTGAATGTCTTCTCAGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-292s21c1
Sequence:CCGGCGTCCCAAAGAAATGGTGTCACTCGAGTGACACCATTTCTTTGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-337s21c1
Sequence:CCGGGCCTTAGGTACGACATCAGAACTCGAGTTCTGATGTCGTACCTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-397s21c1
Sequence:CCGGTCTGAAGGGCAGCCATCATTGCTCGAGCAATGATGGCTGCCCTTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002195
VALIDATED
INSL4 MISSION shRNA Lentiviral Transduction Particles
insulin-like 4 (placenta)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-337s1c1
Sequence:CCGGGCCTTAGGTACGACATCAGAACTCGAGTTCTGATGTCGTACCTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-151s1c1
Sequence:CCGGCTGAGCCAACTCCTTAGAGAACTCGAGTTCTCTAAGGAGTTGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-292s1c1
Sequence:CCGGCGTCCCAAAGAAATGGTGTCACTCGAGTGACACCATTTCTTTGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-339s1c1
Sequence:CCGGCTTAGGTACGACATCAGAATTCTCGAGAATTCTGATGTCGTACCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002195.1-453s1c1
Sequence:CCGGACGTCACAGATTTGATCCATTCTCGAGAATGGATCAAATCTGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-314s21c1
Sequence:CCGGCCTCCAACAACAAAGATGGACCTCGAGGTCCATCTTTGTTGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-361s21c1
Sequence:CCGGATTCCTAATTTGTCACCAGAGCTCGAGCTCTGGTGACAAATTAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-151s21c1
Sequence:CCGGCTGAGCCAACTCCTTAGAGAACTCGAGTTCTCTAAGGAGTTGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-237s21c1
Sequence:CCGGCATGCCTGAGAAGACATTCACCTCGAGGTGAATGTCTTCTCAGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002195.1-292s21c1
Sequence:CCGGCGTCCCAAAGAAATGGTGTCACTCGAGTGACACCATTTCTTTGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-337s21c1
Sequence:CCGGGCCTTAGGTACGACATCAGAACTCGAGTTCTGATGTCGTACCTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002195.1-397s21c1
Sequence:CCGGTCTGAAGGGCAGCCATCATTGCTCGAGCAATGATGGCTGCCCTTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)