EMAIL THIS PAGE TO A FRIEND

INSL6

insulin-like 6

174 Gene Product Result for
Synonyms: RIF1
UniProtKB ID: Q9Y581, A0AVS0, Q9NS16
Gene ID:
Human(11172) Summary: The protein encoded by this gene contains a classical signature of the insulin superfamily and is significantly similar to relaxin and relaxin-like factor. This gene is preferentially expressed in testis. Its expression in testis is restricted to interstitial cells surrounding seminiferous tubules, which suggests a role in sperm development and fertilization. [provided by RefSeq, Jul 2008]
Mouse(27356) insulin-like 6
Rat(50546) insulin-like 6
dog(476343) insulin-like 6
cow(774023) insulin-like 6
sheep(101114333) insulin-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021364 Anti-INSL6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016421 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014871 MISSION® esiRNA esiRNA targeting mouse Insl6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007179 Rosetta Predictions human pricing
NM_022583 Rosetta Predictions rat pricing
NM_013754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163976 predicted 302
2 SASI_Hs01_00163977 predicted 351
3 SASI_Hs01_00163978 predicted 289
4 SASI_Hs01_00163979 predicted 419
5 SASI_Hs01_00163980 predicted 335
6 SASI_Hs02_00343137 predicted 298
7 SASI_Hs01_00163981 predicted 236
8 SASI_Hs01_00163982 predicted 456
9 SASI_Hs01_00163983 predicted 340
10 SASI_Hs01_00163984 predicted 347
11 SASI_Hs01_00163985 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069603 predicted 466
2 SASI_Rn01_00069604 predicted 374
3 SASI_Rn01_00069605 predicted 381
4 SASI_Rn01_00069606 predicted 392
5 SASI_Rn01_00069607 predicted 466
6 SASI_Rn01_00069608 predicted 466
7 SASI_Rn01_00069609 predicted 462
8 SASI_Rn01_00069610 predicted 345
9 SASI_Rn01_00069611 predicted 372
10 SASI_Rn01_00069612 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088146 predicted 201
2 SASI_Mm02_00322700 predicted 247
3 SASI_Mm01_00088147 predicted 348
4 SASI_Mm01_00088148 predicted 397
5 SASI_Mm01_00088149 predicted 353
6 SASI_Mm01_00088150 predicted 390
7 SASI_Mm01_00088151 predicted 389
8 SASI_Mm01_00088152 predicted 359
9 SASI_Mm01_00088153 predicted 329
10 SASI_Mm01_00088154 predicted 216
11 SASI_Mm01_00088155 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013754
INSL6 MISSION shRNA Bacterial Glycerol Stock
insulin-like 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-411s1c1
Sequence:CCGGGAGCGTACAACTTCAGAAGAACTCGAGTTCTTCTGAAGTTGTACGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-494s1c1
Sequence:CCGGGCAGAGGCTTTGCAGATAAGTCTCGAGACTTATCTGCAAAGCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-284s1c1
Sequence:CCGGGCGTCTCTCAGAAGAAAGGAACTCGAGTTCCTTTCTTCTGAGAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-174s1c1
Sequence:CCGGGCAAAGTCCTATGACACAGTTCTCGAGAACTGTGTCATAGGACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-361s1c1
Sequence:CCGGCTTCCTAAGGCAAGAGTGTTTCTCGAGAAACACTCTTGCCTTAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013754
INSL6 MISSION shRNA shRNA Plasmid DNA
insulin-like 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-411s1c1
Sequence:CCGGGAGCGTACAACTTCAGAAGAACTCGAGTTCTTCTGAAGTTGTACGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-494s1c1
Sequence:CCGGGCAGAGGCTTTGCAGATAAGTCTCGAGACTTATCTGCAAAGCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-284s1c1
Sequence:CCGGGCGTCTCTCAGAAGAAAGGAACTCGAGTTCCTTTCTTCTGAGAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-174s1c1
Sequence:CCGGGCAAAGTCCTATGACACAGTTCTCGAGAACTGTGTCATAGGACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-361s1c1
Sequence:CCGGCTTCCTAAGGCAAGAGTGTTTCTCGAGAAACACTCTTGCCTTAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013754
INSL6 MISSION shRNA Lentiviral Transduction Particles
insulin-like 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-411s1c1
Sequence:CCGGGAGCGTACAACTTCAGAAGAACTCGAGTTCTTCTGAAGTTGTACGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-494s1c1
Sequence:CCGGGCAGAGGCTTTGCAGATAAGTCTCGAGACTTATCTGCAAAGCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-284s1c1
Sequence:CCGGGCGTCTCTCAGAAGAAAGGAACTCGAGTTCCTTTCTTCTGAGAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-174s1c1
Sequence:CCGGGCAAAGTCCTATGACACAGTTCTCGAGAACTGTGTCATAGGACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013754.1-361s1c1
Sequence:CCGGCTTCCTAAGGCAAGAGTGTTTCTCGAGAAACACTCTTGCCTTAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007179
INSL6 MISSION shRNA Bacterial Glycerol Stock
insulin-like 6
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000165693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007179.2-302s1c1
Sequence:CCGGCCAGTGTCTACTTCTTGGGAACTCGAGTTCCCAAGAAGTAGACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007179.2-118s1c1
Sequence:CCGGCAGGTACTTGGTGAAAGAAATCTCGAGATTTCTTTCACCAAGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007179
INSL6 MISSION shRNA shRNA Plasmid DNA
insulin-like 6
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000165693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007179.2-302s1c1
Sequence:CCGGCCAGTGTCTACTTCTTGGGAACTCGAGTTCCCAAGAAGTAGACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007179.2-118s1c1
Sequence:CCGGCAGGTACTTGGTGAAAGAAATCTCGAGATTTCTTTCACCAAGTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007179
INSL6 MISSION shRNA Lentiviral Transduction Particles
insulin-like 6
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000165693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007179.2-302s1c1
Sequence:CCGGCCAGTGTCTACTTCTTGGGAACTCGAGTTCCCAAGAAGTAGACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007179.2-118s1c1
Sequence:CCGGCAGGTACTTGGTGAAAGAAATCTCGAGATTTCTTTCACCAAGTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016421
INSL6 MISSION shRNA Bacterial Glycerol Stock
insulin-like 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-330s1c1
Sequence:CCGGGCAGTCACTACCTGAGTATAACTCGAGTTATACTCAGGTAGTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-335s1c1
Sequence:CCGGCACTACCTGAGTATAAGGATACTCGAGTATCCTTATACTCAGGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-442s1c1
Sequence:CCGGCAGAAGAAACGTAGAAACAAACTCGAGTTTGTTTCTACGTTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-105s1c1
Sequence:CCGGGTACTTGGTGAAAGAAATAGACTCGAGTCTATTTCTTTCACCAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-373s1c1
Sequence:CCGGCTTGGTAAGACAAGAGAATTTCTCGAGAAATTCTCTTGTCTTACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-289s1c1
Sequence:CCGGGTGTCTACTTCTTGGGAAGAACTCGAGTTCTTCCCAAGAAGTAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-278s1c1
Sequence:CCGGGCACAAACCCAGTGTCTACTTCTCGAGAAGTAGACACTGGGTTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-101s1c1
Sequence:CCGGGCAGGTACTTGGTGAAAGAAACTCGAGTTTCTTTCACCAAGTACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-307s1c1
Sequence:CCGGGAAGCAGTAAACAGTTGGGAACTCGAGTTCCCAACTGTTTACTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016421
INSL6 MISSION shRNA shRNA Plasmid DNA
insulin-like 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-330s1c1
Sequence:CCGGGCAGTCACTACCTGAGTATAACTCGAGTTATACTCAGGTAGTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-335s1c1
Sequence:CCGGCACTACCTGAGTATAAGGATACTCGAGTATCCTTATACTCAGGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-442s1c1
Sequence:CCGGCAGAAGAAACGTAGAAACAAACTCGAGTTTGTTTCTACGTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-105s1c1
Sequence:CCGGGTACTTGGTGAAAGAAATAGACTCGAGTCTATTTCTTTCACCAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-373s1c1
Sequence:CCGGCTTGGTAAGACAAGAGAATTTCTCGAGAAATTCTCTTGTCTTACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-289s1c1
Sequence:CCGGGTGTCTACTTCTTGGGAAGAACTCGAGTTCTTCCCAAGAAGTAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-278s1c1
Sequence:CCGGGCACAAACCCAGTGTCTACTTCTCGAGAAGTAGACACTGGGTTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-101s1c1
Sequence:CCGGGCAGGTACTTGGTGAAAGAAACTCGAGTTTCTTTCACCAAGTACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-307s1c1
Sequence:CCGGGAAGCAGTAAACAGTTGGGAACTCGAGTTCCCAACTGTTTACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016421
INSL6 MISSION shRNA Lentiviral Transduction Particles
insulin-like 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-330s1c1
Sequence:CCGGGCAGTCACTACCTGAGTATAACTCGAGTTATACTCAGGTAGTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-335s1c1
Sequence:CCGGCACTACCTGAGTATAAGGATACTCGAGTATCCTTATACTCAGGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-442s1c1
Sequence:CCGGCAGAAGAAACGTAGAAACAAACTCGAGTTTGTTTCTACGTTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016421.1-105s1c1
Sequence:CCGGGTACTTGGTGAAAGAAATAGACTCGAGTCTATTTCTTTCACCAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-373s1c1
Sequence:CCGGCTTGGTAAGACAAGAGAATTTCTCGAGAAATTCTCTTGTCTTACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-289s1c1
Sequence:CCGGGTGTCTACTTCTTGGGAAGAACTCGAGTTCTTCCCAAGAAGTAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-278s1c1
Sequence:CCGGGCACAAACCCAGTGTCTACTTCTCGAGAAGTAGACACTGGGTTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-101s1c1
Sequence:CCGGGCAGGTACTTGGTGAAAGAAACTCGAGTTTCTTTCACCAAGTACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016421.1-307s1c1
Sequence:CCGGGAAGCAGTAAACAGTTGGGAACTCGAGTTCCCAACTGTTTACTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)