EMAIL THIS PAGE TO A FRIEND

INSM1

insulinoma-associated 1

120 Gene Product Result for
Synonyms: IA-1 IA1
UniProtKB ID: Q01101
Gene ID:
Human(3642) Summary: Insulinoma-associated 1 (INSM1) gene is intronless and encodes a protein containing both a zinc finger DNA-binding domain and a putative prohormone domain. This gene is a sensitive marker for neuroendocrine differentiation of human lung tumors. [provided by RefSeq, Jul 2008]
Mouse(53626) insulinoma-associated 1
Rat(366210) insulinoma-associated 1
cow(100137721) insulinoma-associated 1
domestic cat(101083417) insulinoma-associated 1
dog(607566) insulinoma-associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002196 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002196 Rosetta Predictions human pricing
XM_001055419 Rosetta Predictions rat pricing
XM_345443 Rosetta Predictions rat pricing
NM_016889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193872 predicted 2065
2 SASI_Hs01_00193874 predicted 1592
3 SASI_Hs02_00333418 predicted 1594
4 SASI_Hs01_00193875 predicted 1612
5 SASI_Hs01_00193876 predicted 2071
6 SASI_Hs01_00193877 predicted 1800
7 SASI_Hs01_00193878 predicted 2127
8 SASI_Hs01_00193880 predicted 2063
9 SASI_Hs01_00193881 predicted 1706
10 SASI_Hs02_00333419 predicted 1961
11 SASI_Hs01_00193873 predicted 2115
12 SASI_Hs01_00193879 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279446 predicted 330
2 SASI_Rn02_00279447 predicted 2277
3 SASI_Rn02_00279448 predicted 325
4 SASI_Rn02_00279449 predicted 352
5 SASI_Rn02_00279450 predicted 2288
6 SASI_Rn02_00279451 predicted 424
7 SASI_Rn02_00279452 predicted 1554
8 SASI_Rn02_00279453 predicted 435
9 SASI_Rn02_00279454 predicted 2287
10 SASI_Rn02_00279455 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398387 predicted 199
2 SASI_Rn02_00398388 predicted 198
3 SASI_Rn02_00398389 predicted 996
4 SASI_Rn02_00398390 predicted 1004
5 SASI_Rn02_00398391 predicted 779
6 SASI_Rn02_00398392 predicted 992
7 SASI_Rn02_00398393 predicted 714
8 SASI_Rn02_00398394 predicted 1075
9 SASI_Rn02_00398395 predicted 171
10 SASI_Rn02_00398396 predicted 6
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174320 predicted 1058
2 SASI_Mm01_00174321 predicted 2191
3 SASI_Mm01_00174322 predicted 2136
4 SASI_Mm01_00174323 predicted 2198
5 SASI_Mm01_00174324 predicted 2156
6 SASI_Mm01_00174325 predicted 1010
7 SASI_Mm01_00174326 predicted 2138
8 SASI_Mm01_00174327 predicted 2155
9 SASI_Mm01_00174328 predicted 2131
10 SASI_Mm01_00174329 predicted 865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016889
INSM1 MISSION shRNA Bacterial Glycerol Stock
insulinoma-associated 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016889.3-2060s21c1
Sequence:CCGGCAACAGGAGTCCGTCTCTTTCCTCGAGGAAAGAGACGGACTCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016889.3-1930s21c1
Sequence:CCGGACTCCCATTCCAGGGTGAAAGCTCGAGCTTTCACCCTGGAATGGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016889.3-603s21c1
Sequence:CCGGCACGAGAAGCACAAGTACTTCCTCGAGGAAGTACTTGTGCTTCTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016889.3-970s21c1
Sequence:CCGGTGCACTTCGAGGACGAGGTGACTCGAGTCACCTCGTCCTCGAAGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1684s1c1
Sequence:CCGGCGTCTGAGAATAGACAGGTGACTCGAGTCACCTGTCTATTCTCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1415s1c1
Sequence:CCGGCGCCGAGGACATCCTGGCTTTCTCGAGAAAGCCAGGATGTCCTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-680s1c1
Sequence:CCGGGCTCAAGATGGGCACTGCGTTCTCGAGAACGCAGTGCCCATCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016889.1-2213s1c1
Sequence:CCGGCCCACACGATTAGCTTTATTACTCGAGTAATAAAGCTAATCGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1037s1c1
Sequence:CCGGGCAGCACAAGTGCTCGCGCATCTCGAGATGCGCGAGCACTTGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016889
INSM1 MISSION shRNA shRNA Plasmid DNA
insulinoma-associated 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016889.3-2060s21c1
Sequence:CCGGCAACAGGAGTCCGTCTCTTTCCTCGAGGAAAGAGACGGACTCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016889.3-1930s21c1
Sequence:CCGGACTCCCATTCCAGGGTGAAAGCTCGAGCTTTCACCCTGGAATGGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016889.3-603s21c1
Sequence:CCGGCACGAGAAGCACAAGTACTTCCTCGAGGAAGTACTTGTGCTTCTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016889.3-970s21c1
Sequence:CCGGTGCACTTCGAGGACGAGGTGACTCGAGTCACCTCGTCCTCGAAGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1684s1c1
Sequence:CCGGCGTCTGAGAATAGACAGGTGACTCGAGTCACCTGTCTATTCTCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1415s1c1
Sequence:CCGGCGCCGAGGACATCCTGGCTTTCTCGAGAAAGCCAGGATGTCCTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-680s1c1
Sequence:CCGGGCTCAAGATGGGCACTGCGTTCTCGAGAACGCAGTGCCCATCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016889.1-2213s1c1
Sequence:CCGGCCCACACGATTAGCTTTATTACTCGAGTAATAAAGCTAATCGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1037s1c1
Sequence:CCGGGCAGCACAAGTGCTCGCGCATCTCGAGATGCGCGAGCACTTGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016889
INSM1 MISSION shRNA Lentiviral Transduction Particles
insulinoma-associated 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016889.3-2060s21c1
Sequence:CCGGCAACAGGAGTCCGTCTCTTTCCTCGAGGAAAGAGACGGACTCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016889.3-1930s21c1
Sequence:CCGGACTCCCATTCCAGGGTGAAAGCTCGAGCTTTCACCCTGGAATGGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016889.3-603s21c1
Sequence:CCGGCACGAGAAGCACAAGTACTTCCTCGAGGAAGTACTTGTGCTTCTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016889.3-970s21c1
Sequence:CCGGTGCACTTCGAGGACGAGGTGACTCGAGTCACCTCGTCCTCGAAGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1684s1c1
Sequence:CCGGCGTCTGAGAATAGACAGGTGACTCGAGTCACCTGTCTATTCTCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1415s1c1
Sequence:CCGGCGCCGAGGACATCCTGGCTTTCTCGAGAAAGCCAGGATGTCCTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-680s1c1
Sequence:CCGGGCTCAAGATGGGCACTGCGTTCTCGAGAACGCAGTGCCCATCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016889.1-2213s1c1
Sequence:CCGGCCCACACGATTAGCTTTATTACTCGAGTAATAAAGCTAATCGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016889.1-1037s1c1
Sequence:CCGGGCAGCACAAGTGCTCGCGCATCTCGAGATGCGCGAGCACTTGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002196
INSM1 MISSION shRNA Bacterial Glycerol Stock
insulinoma-associated 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-1485s1c1
Sequence:CCGGCGGAGAGTCGTTCGCCAGCAACTCGAGTTGCTGGCGAACGACTCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-1251s1c1
Sequence:CCGGGTGCCATCACTGCGCCAAGAACTCGAGTTCTTGGCGCAGTGATGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-996s1c1
Sequence:CCGGGCAGCACAAATGCTCGCGCATCTCGAGATGCGCGAGCATTTGTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-474s1c1
Sequence:CCGGGCACGAGAAGCACAAGTACTTCTCGAGAAGTACTTGTGCTTCTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002196.2-2168s1c1
Sequence:CCGGCCACACGATTAGCTTTATTATCTCGAGATAATAAAGCTAATCGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002196.2-1715s21c1
Sequence:CCGGTTCGCTTGGAGACCCACAAAGCTCGAGCTTTGTGGGTCTCCAAGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002196.2-1918s21c1
Sequence:CCGGCAACAGGAGTCAGTCTCTTTCCTCGAGGAAAGAGACTGACTCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002196
INSM1 MISSION shRNA shRNA Plasmid DNA
insulinoma-associated 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-1485s1c1
Sequence:CCGGCGGAGAGTCGTTCGCCAGCAACTCGAGTTGCTGGCGAACGACTCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-1251s1c1
Sequence:CCGGGTGCCATCACTGCGCCAAGAACTCGAGTTCTTGGCGCAGTGATGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-996s1c1
Sequence:CCGGGCAGCACAAATGCTCGCGCATCTCGAGATGCGCGAGCATTTGTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-474s1c1
Sequence:CCGGGCACGAGAAGCACAAGTACTTCTCGAGAAGTACTTGTGCTTCTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002196.2-2168s1c1
Sequence:CCGGCCACACGATTAGCTTTATTATCTCGAGATAATAAAGCTAATCGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002196.2-1715s21c1
Sequence:CCGGTTCGCTTGGAGACCCACAAAGCTCGAGCTTTGTGGGTCTCCAAGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002196.2-1918s21c1
Sequence:CCGGCAACAGGAGTCAGTCTCTTTCCTCGAGGAAAGAGACTGACTCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002196
INSM1 MISSION shRNA Lentiviral Transduction Particles
insulinoma-associated 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-1485s1c1
Sequence:CCGGCGGAGAGTCGTTCGCCAGCAACTCGAGTTGCTGGCGAACGACTCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-1251s1c1
Sequence:CCGGGTGCCATCACTGCGCCAAGAACTCGAGTTCTTGGCGCAGTGATGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-996s1c1
Sequence:CCGGGCAGCACAAATGCTCGCGCATCTCGAGATGCGCGAGCATTTGTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002196.2-474s1c1
Sequence:CCGGGCACGAGAAGCACAAGTACTTCTCGAGAAGTACTTGTGCTTCTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002196.2-2168s1c1
Sequence:CCGGCCACACGATTAGCTTTATTATCTCGAGATAATAAAGCTAATCGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002196.2-1715s21c1
Sequence:CCGGTTCGCTTGGAGACCCACAAAGCTCGAGCTTTGTGGGTCTCCAAGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002196.2-1918s21c1
Sequence:CCGGCAACAGGAGTCAGTCTCTTTCCTCGAGGAAAGAGACTGACTCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)