EMAIL THIS PAGE TO A FRIEND

INSM2

insulinoma-associated 2

88 Gene Product Result for
Synonyms: IA-6 IA6 mlt1
UniProtKB ID: Q96T92, A1L432, Q8N8K7, Q96Q84
Gene ID:
Mouse(56856) insulinoma-associated 2
Rat(314131) insulinoma-associated 2
cow(614156) insulinoma-associated 2
domestic cat(101091119) insulinoma-associated 2
dog(490652) insulinoma-associated 2
domestic guinea pig(100729092) insulinoma-associated 2
naked mole-rat(101708641) insulinoma-associated 2
sheep(101104274) insulinoma-associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000481 MISSION® esiRNA esiRNA targeting human INSM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032594 Rosetta Predictions human pricing
XM_001079190 Rosetta Predictions rat pricing
XM_234255 Rosetta Predictions rat pricing
NM_020287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231379 predicted 1088
2 SASI_Hs01_00231381 predicted 1060
3 SASI_Hs01_00231382 predicted 1510
4 SASI_Hs01_00231384 predicted 1925
5 SASI_Hs02_00360133 predicted 1100
6 SASI_Hs01_00231385 predicted 1535
7 SASI_Hs01_00231386 predicted 1789
8 SASI_Hs01_00231387 predicted 1916
9 SASI_Hs01_00231388 predicted 1261
10 SASI_Hs02_00360134 predicted 1984
11 SASI_Hs01_00231380 predicted 1136
12 SASI_Hs01_00231383 predicted 1949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363415 predicted 1497
2 SASI_Rn02_00363416 predicted 1650
3 SASI_Rn02_00363417 predicted 1422
4 SASI_Rn02_00363418 predicted 1522
5 SASI_Rn02_00363419 predicted 1654
6 SASI_Rn02_00363420 predicted 1649
7 SASI_Rn02_00363421 predicted 1691
8 SASI_Rn02_00363422 predicted 456
9 SASI_Rn02_00363423 predicted 230
10 SASI_Rn02_00363424 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388366 predicted 1556
2 SASI_Rn02_00388367 predicted 1709
3 SASI_Rn02_00388368 predicted 1476
4 SASI_Rn02_00388369 predicted 1712
5 SASI_Rn02_00388370 predicted 1713
6 SASI_Rn02_00388371 predicted 1205
7 SASI_Rn02_00388372 predicted 1742
8 SASI_Rn02_00388373 predicted 1544
9 SASI_Rn02_00388374 predicted 1553
10 SASI_Rn02_00388375 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325497 predicted 2149
2 SASI_Mm02_00325498 predicted 2097
3 SASI_Mm01_00198410 predicted 1766
4 SASI_Mm01_00198411 predicted 1493
5 SASI_Mm02_00325499 predicted 2158
6 SASI_Mm02_00325500 predicted 1887
7 SASI_Mm02_00325501 predicted 2046
8 SASI_Mm02_00325502 predicted 1949
9 SASI_Mm02_00325503 predicted 2025
10 SASI_Mm02_00325504 predicted 2093
11 SASI_Mm01_00198408 predicted 1056
12 SASI_Mm01_00198409 predicted 373
13 SASI_Mm01_00198412 predicted 500
14 SASI_Mm01_00198413 predicted 1210
15 SASI_Mm01_00198414 predicted 1049
16 SASI_Mm01_00198415 predicted 1058
17 SASI_Mm01_00198416 predicted 1233
18 SASI_Mm01_00198417 predicted 941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032594
INSM2 MISSION shRNA Bacterial Glycerol Stock
insulinoma-associated 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032594.2-1490s1c1
Sequence:CCGGGTGTGCCCATATTGCCACAAACTCGAGTTTGTGGCAATATGGGCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032594.3-1269s21c1
Sequence:CCGGGAAAGGAGAACAGCCGAATAGCTCGAGCTATTCGGCTGTTCTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032594.2-872s1c1
Sequence:CCGGGCCATGAGGAAGTTGAGCTTTCTCGAGAAAGCTCAACTTCCTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032594.3-2202s21c1
Sequence:CCGGGACCCTAACGAATCCTATATGCTCGAGCATATAGGATTCGTTAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032594.3-1764s21c1
Sequence:CCGGACGGGAGTGCCCAGCAAATTTCTCGAGAAATTTGCTGGGCACTCCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032594
INSM2 MISSION shRNA shRNA Plasmid DNA
insulinoma-associated 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032594.2-1490s1c1
Sequence:CCGGGTGTGCCCATATTGCCACAAACTCGAGTTTGTGGCAATATGGGCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032594.3-1269s21c1
Sequence:CCGGGAAAGGAGAACAGCCGAATAGCTCGAGCTATTCGGCTGTTCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032594.2-872s1c1
Sequence:CCGGGCCATGAGGAAGTTGAGCTTTCTCGAGAAAGCTCAACTTCCTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032594.3-2202s21c1
Sequence:CCGGGACCCTAACGAATCCTATATGCTCGAGCATATAGGATTCGTTAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032594.3-1764s21c1
Sequence:CCGGACGGGAGTGCCCAGCAAATTTCTCGAGAAATTTGCTGGGCACTCCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032594
INSM2 MISSION shRNA Lentiviral Transduction Particles
insulinoma-associated 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032594.2-1490s1c1
Sequence:CCGGGTGTGCCCATATTGCCACAAACTCGAGTTTGTGGCAATATGGGCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032594.3-1269s21c1
Sequence:CCGGGAAAGGAGAACAGCCGAATAGCTCGAGCTATTCGGCTGTTCTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032594.2-872s1c1
Sequence:CCGGGCCATGAGGAAGTTGAGCTTTCTCGAGAAAGCTCAACTTCCTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032594.3-2202s21c1
Sequence:CCGGGACCCTAACGAATCCTATATGCTCGAGCATATAGGATTCGTTAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032594.3-1764s21c1
Sequence:CCGGACGGGAGTGCCCAGCAAATTTCTCGAGAAATTTGCTGGGCACTCCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020287
INSM2 MISSION shRNA Bacterial Glycerol Stock
insulinoma-associated 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-497s1c1
Sequence:CCGGGCTTCGCAGATGAGGTGACCACTCGAGTGGTCACCTCATCTGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-367s1c1
Sequence:CCGGGTCCCTGTATCCGTTCCAATTCTCGAGAATTGGAACGGATACAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-528s1c1
Sequence:CCGGGCTGGGTCTGAAGATCAAAGACTCGAGTCTTTGATCTTCAGACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-1063s1c1
Sequence:CCGGGTGTGCCCGTATTGTCACAAACTCGAGTTTGTGACAATACGGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-1143s1c1
Sequence:CCGGCCGTGCACCAACTCCGGGTTTCTCGAGAAACCCGGAGTTGGTGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020287
INSM2 MISSION shRNA shRNA Plasmid DNA
insulinoma-associated 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-497s1c1
Sequence:CCGGGCTTCGCAGATGAGGTGACCACTCGAGTGGTCACCTCATCTGCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-367s1c1
Sequence:CCGGGTCCCTGTATCCGTTCCAATTCTCGAGAATTGGAACGGATACAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-528s1c1
Sequence:CCGGGCTGGGTCTGAAGATCAAAGACTCGAGTCTTTGATCTTCAGACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-1063s1c1
Sequence:CCGGGTGTGCCCGTATTGTCACAAACTCGAGTTTGTGACAATACGGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-1143s1c1
Sequence:CCGGCCGTGCACCAACTCCGGGTTTCTCGAGAAACCCGGAGTTGGTGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020287
INSM2 MISSION shRNA Lentiviral Transduction Particles
insulinoma-associated 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-497s1c1
Sequence:CCGGGCTTCGCAGATGAGGTGACCACTCGAGTGGTCACCTCATCTGCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-367s1c1
Sequence:CCGGGTCCCTGTATCCGTTCCAATTCTCGAGAATTGGAACGGATACAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-528s1c1
Sequence:CCGGGCTGGGTCTGAAGATCAAAGACTCGAGTCTTTGATCTTCAGACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-1063s1c1
Sequence:CCGGGTGTGCCCGTATTGTCACAAACTCGAGTTTGTGACAATACGGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020287.1-1143s1c1
Sequence:CCGGCCGTGCACCAACTCCGGGTTTCTCGAGAAACCCGGAGTTGGTGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)